• Users Online: 93
  • Print this page
  • Email this page

 
Table of Contents
ORIGINAL ARTICLE
Year : 2019  |  Volume : 62  |  Issue : 2  |  Page : 70-79

Different susceptibilities of osteoclasts and osteoblasts to glucocorticoid-induced oxidative stress and mitochondrial alterations


1 Institute of Biotechnology, National Taiwan University, Taipei; Department of Orthopedics, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan; Department of Orthopedics, National Defense Medical Center, Tri-Service General Hospital, Taipei, Taiwan
2 Department of Animal Science, National Pingtung University of Science and Technology, Pingtung, Taiwan
3 Department of Orthopedics, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan, Taiwan
4 Department of Animal Science and Technology, National Taiwan University, Taipei; Department of Animal Science and Biotechnology, Tunghai University, Taichung, Taiwan
5 Institute of Biotechnology, National Taiwan University; Department of Animal Science and Technology, National Taiwan University, Taipei, Taiwan

Date of Submission21-Jan-2019
Date of Decision14-Mar-2019
Date of Acceptance05-Apr-2019
Date of Web Publication25-Apr-2019

Correspondence Address:
Dr. Shinn-Chih Wu
No. 50, Lane 155, Section 3, Keelung Rd., Da'an District, Taipei 10672
Taiwan
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/CJP.CJP_7_19

Rights and Permissions
  Abstract 

Glucocorticoid-induced bone loss is the most common form of secondary osteoporosis. This toxic effect has not been efficiently managed, possibly due to the incomplete understanding of the extraordinarily diverse cellular responses induced by glucocorticoid treatment. Previous literatures revealed that high dose of exogenous glucocorticoid triggers apoptosis in osteocytes and osteoblasts. This cell death is associated with glucocorticoid-induced oxidative stress. In this study, we aimed to investigate the mechanisms of glucocorticoid-induced apoptosis in osteoblasts and examine the responses of osteoclasts to the synthetic glucocorticoid, dexamethasone. We demonstrated the biphasic effects of exogenous glucocorticoid on osteoblastic mitochondrial functions and elevated intracellular oxidative stress in a dose- and time-dependent manner. On comparison, similar treatment did not induce mitochondrial dysfunctions and oxidative stress in osteoclasts. The production of reactive oxygen/nitrogen species was decreased in osteoclasts. The differences are not due to varying efficiency of cellular antioxidant system. The opposite effects on nitrogen oxide synthase might provide an explanation, as the expression levels of nos2 gene are suppressed in the osteoclast but elevated in the osteoblast. We further revealed that glucocorticoids have a substantial impact on the osteoblastic mitochondria. Basal respiration rate and ATP production were increased upon 24 h incubation of glucocorticoids. The increase in proton leak and nonmitochondrial respiration suggests a potential source of glucocorticoid-induced oxidative stress. Long-term incubation of glucocorticoids accumulates these detrimental changes and results in cytochrome C release and mitochondrial breakdown, consequently leading to apoptosis in osteoblasts. The mitochondrial alterations might be other sources of glucocorticoid-induced oxidative stress in osteoblasts.

Keywords: Apoptosis, glucocorticoids, osteoblasts, osteoclasts, oxidative stress


How to cite this article:
Chen YH, Peng SY, Cheng MT, Hsu YP, Huang ZX, Cheng WT, Wu SC. Different susceptibilities of osteoclasts and osteoblasts to glucocorticoid-induced oxidative stress and mitochondrial alterations. Chin J Physiol 2019;62:70-9

How to cite this URL:
Chen YH, Peng SY, Cheng MT, Hsu YP, Huang ZX, Cheng WT, Wu SC. Different susceptibilities of osteoclasts and osteoblasts to glucocorticoid-induced oxidative stress and mitochondrial alterations. Chin J Physiol [serial online] 2019 [cited 2019 Jul 20];62:70-9. Available from: http://www.cjphysiology.org/text.asp?2019/62/2/70/257185

Yu-Hsu Chen & Shao-Yu Peng - Co-first authors



  Introduction Top


Glucocorticoid-induced osteoporosis (GIO) is the most common form of secondary osteoporosis and the important cause of osteoporosis in young people.[1],[2] The relative risk of bone fracture induced by GIO increases as a function of glucocorticoids' dosage and duration of treatment. Fracture starts to occur from a few months after the start of treatment.[3],[4] Nearly 20% of patients received the glucocorticoid treatment suffer from pathologic fracture within the first 12 months. [5,6] Bone is a dynamic tissue and hence, bone remodeling process occurs throughout life. Osteoblasts and osteoclasts are two major cells that are involved in bone remodeling.[7],[8] Osteoporosis could be attributed to an imbalance between bone formation by osteoblasts and resorption by osteoclasts.[9]

Cellular responses to glucocorticoid treatment are remarkably diverse, exhibiting profound variability in specificity and sensitivity, possibly due to the varied expression of cofactors and glucocorticoid receptor (GR) isoforms in different cell types.[10] For example, glucocorticoids are potent inducers of apoptosis in thymocytes and osteoblasts, but promote survival in hepatocytes and cardiomyocytes.[11] The cellular responses of osteoblasts and osteoclasts have been characterized to understand the molecular and cellular mechanisms of GIO. Previous studies showed that glucocorticoid promotes apoptosis of osteoblasts and osteocytes in vitro.[12],[13],[14] Furthermore, the excess glucocorticoids directly induce the apoptosis of osteoblasts and osteocytes and reduce bone formation and strength in vivo.[15] Increased apoptosis of osteoblasts and osteocytes is one of the mechanisms that underlie the reduced bone formation and bone fragility that characterize GIO. In contrast, dexamethasone (DEX) directly stimulated the proliferation and differentiation of human osteoclast precursors and inhibited resorption by mature osteoclasts.[16] Also, patients received steroid treatment caused an increase in osteoclast numbers and sites of lacunar resorption in the bones. These increases were thought to be due to either increased formation and/or survival of osteoclasts.[16],[17] In the alveolar bone study, the short period (2 weeks) of DEX treatment significantly increased the number of osteoclasts in rabbits.[18] Based on that study, the results suggested that glucocorticoids affect differently on osteoblasts and osteoclasts. However, detailed molecular mechanisms of how glucocorticoids influence those two types of cells are not fully understood.

Few hypotheses about glucocorticoid-induced apoptosis in osteoblast have been proposed. The osteoblast differentiation is inhibited by glucocorticoids through the induction of adipogenetic transcription factors (PPARγ) and suppression of Wnt signaling.[19],[20],[21] Moreover, high dose of glucocorticoids elevates osteoblast and osteocyte apoptosis possibly by a few different routes. Activated GR increases the expression of pro-apoptotic proteins such as Bad, Bim, and Bax, and subsequently induces caspase 3 activation. However, glucocorticoid-treated mice exhibit bone loss in comparable levels with intact or disrupted glucocorticoid signaling, suggesting that other mechanisms should be involved.[22] Another possible way is through increasing oxidative stress. Administration of prednisolone to mice increased reactive oxygen species (ROS) in bone.[23] The generation of ROS by DEX was responsible for the activation of JNK and induction of apoptosis in the cultured osteoblast.[23] In addition, osteoblasts treated with DEX induced signs of oxidative damages including depletion in total antioxidant capacity, increased ROS formation, and enhanced lipid peroxidation.[24] Antioxidant N-acetylcysteine (NAC) attenuates the DEX-induced cytotoxic effects in osteoblasts.[25]

This work aimed to test the hypothesis that DEX exposure induces the production of ROS/reactive nitrogen species (ROS/RNS) and mitochondrial alterations in osteoblasts but not in osteoclasts. We anticipated that osteoclasts have different responses to DEX treatment. The results support the hypothesis and suggest that the increase of osteoclast proliferation and mitochondrial dysfunctions in osteoblasts leads to the imbalance of bone remodeling and could be the main cause of bone loss.


  Materials and Methods Top


Cell culture and treatment

The murine preosteoblastic calvarial cell line MC3T3-E1 subclone 4 was obtained from ATCC (ATCC®, USA, CRL-2593™). Cells were cultured in α-Minimum Essential Medium (α-MEM) (Gibco, Thermo Fisher Scientific, USA)supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% P/S (Gibco) at 37°C in a humidified atmosphere containing 5% CO2. To obtain osteoblasts, MC3T3-E1 cells were grown for 7 days in α-MEM containing 1% FBS, 1% P/S, 10 mM β-glycerol phosphate (Sigma Aldrich, USA), and 50 μg/ml L-ascorbic acid (Sigma Aldrich, USA).[26]

The murine macrophage cell line RAW264.7 subclone 2 was obtained from ATCC (ATCC® TIB-71™). Cells were grown in DMEM (Gibco, Thermo Fisher Scientific Inc.) supplemented with 10% (v/v) FBS and 1% (v/v) penicillin-streptomycin solution, and incubated at 37°C in 5% CO2 humidified air. The medium was changed every 3 days. To obtain osteoclasts, RAW264.7 cells were grown for 6 days in DMEM containing 10% FBS, 1% P/S, and 50 ng/ml mRANKL (PeproTech, Rocky Hill, NJ, USA).[27]

Alkaline phosphatase staining

Alkaline phosphatase (ALP) staining was performed by 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) method. Briefly, after washing cells with phosphate-buffered saline (PBS) once, the cells were fixed in 4% paraformaldehyde for 2 min and rinsed with distilled water twice. Then, the cells were stained with BCIP/NBT ALP substrate (Promega, Madison, WI, USA) for 20 min in the dark at room temperature. The reaction was stopped by removing the substrate solution and washed with distilled water. ALP-positive cells were indicated by dark purple staining under a stereoscopic microscope.

Tartrate-resistant acid phosphatase staining

Tartrate-resistant acid phosphatase (TRAP) histochemical staining of the cells was performed using a leukocyte acid phosphatase kit (Sigma) following the protocol. Cells were rinsed with PBS, fixed in 4% paraformaldehyde for 30 s at room temperature, washed in distilled water, and air-dried. After TRAP staining, TRAP-positive multinucleated cells (more than three nuclei) can be visualized under a phase-contrast microscope.

MTT assay

MC3T3-E1 and RAW264.7 were plated into 96-well plates and grown in differentiation medium for the indicated days. Cells were treated with different concentrations of DEX for 24 or 48 h according to the experimental design. Subsequently, the medium was removed, and cells were cultured in 100 μL fresh medium containing 10% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) for 4 h at 37°C. The supernatant was removed, and the formazan crystals were dissolved in 100 μL of dimethyl sulfoxide (DMSO). Absorbance was recorded at 595 nm using a microplate reader.[28]

In vitro reactive oxygen species/reactive nitrogen species assay

OxiSelect™In vitro ROS/RNS assay kit (green fluorescence) (Cell Biolabs, Cat. STA-347) was used to measure ROS and RNS in differentiated osteoblasts and osteoclasts. Cells were homogenized and centrifuged at 10,000 g for 5 min to remove insoluble particles. 50 μl of the supernatant was mixed with 50 μl catalyst (provided in the kit) to accelerate the oxidative reaction. Following 5 min incubation at room temperature, 100 μl dichlorodihydrofluorescin DiOxyQ (DCFH-DiOxyQ) probe solution was added to the mixture to measure the total free radical population. The DCFH probe can react with free radical molecules that are representative of both ROS and RNS. The samples were incubated at room temperature for 30 min and read with a fluorescence plate reader at excitation/emission = 480/530 nm. The standard curve of hydrogen peroxide (H2O2) was used to quantify the free radical content in the cell lysates.

Reverse transcription-quantitative polymerase chain reaction assay

Total RNA was extracted using RNAzol® reagent (Mrcgene; Molecular Research Center, Inc., USA), according to the manufacturer's protocol. cDNA was synthesized using a IQ2 MMLV RT-Script kit (Bio-Genesis Technologies Inc., TW) according to the manufacturer's protocol. Quantitative polymerase chain reaction (PCR) was performed using SYBR-Green (Applied Biosystems™, Thermo Fisher Scientific Inc., USA), and data collection was conducted using an ABI 7300 (Applied Biosystems; Thermo Fisher Scientific Inc.). The PCR cycling conditions were as follows: 95°C for 2 min, followed by 40 cycles at 95°C for 20 s, 58°C or 53°C for 20 s, and 72°C for 40 s, and a final extension step of 95°C for 15 s, 60°C for 1 min, 95°C for 15 s, and 60°C for 15 s. Primer sequences were as follows:

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH):

Forward: GCACAGTCAAGGCCGAGAAT

Reverse: GCCTTCTCCATGGTGGTGAA;

Catalase (CAT):

Forward: GCAGATACCTGTGAACTGTC

Reverse: GTAGAATGTCCGCACCTGAG;

Superoxide dismutase (SOD) SOD1:

Forward: CCAGTGCAGGACCTCATTTT

Reverse: CACCTTTGCCCAAGTCATCT;

Glutathione peroxidase (GPx) GPx-1:

Forward: CCTCAAGTACGTCCGACCTG

Reverse: CAATGTCGTTGCGGCACACC;

Inducible NO synthase (iNOS):

Forward: CTTTGCCACGGACGAGAC

Reverse: TCATTGTACTCTGAGGGCTGA.

GAPDH was used as an internal control for normalization. Gene expression was calculated using the delta-delta Ct method.

Seahorse oxygen consumption rate

Differentiated osteoblasts and osteoclasts were assayed in DMEM (did not contain sodium bicarbonate or HEPES) as described.[29] MC3T3-E1 and RAW264.7 cells were plated at 5000 and 3000 cells per well in 24-well Seahorse V7 culture plates (Agilent Seahorse, USA, #100777004) in 100 μl of the differentiation medium for the indicated days. Cells were treated with 10−6 M DEX for 24 or 48 h, and subsequently, OCR was measured on a Seahorse XF24 as described by the manufacturer, with modifications. Briefly, cells were changed into DMEM without additional exogenous substrates. For the mitochondrial stress test, the inhibitors were added through the injection ports by the following order. 1 μM oligomycin, 1 (osteoclasts) and 4 (osteoblasts) μM FCCP [Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone], and 0.5 μM each of antimycin A and rotenone.[29]

Cytochrome C release assay

Cytochrome C release was analyzed by Western blotting. The cytosol and mitochondrial lysate were extracted using the cytochrome C apoptosis assay kit (BioVision, USA, #K257). Cytosolic and mitochondrial proteins at a final protein amount of 20 μg were loaded onto an sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel (NuSep, Bio-Rad, USA) and were electrophoresed. Subsequently, the separated proteins were transferred onto polyvinylidene difluoride membranes and were immunoblotted using the cytochrome C primary antibody overnight at 4°C, followed by incubation with an horseradish peroxidase-labeled secondary antibody. The protein bands were visualized using the enhanced chemiluminescence (ECL) method.

Statistical analysis

Data were expressed as pooled mean ± standard error of the mean of at least three independent experiments. Statistical analysis was performed using one-way ANOVA test followed by Tukey's multiple comparison test, or Student's t-test, by GraphPad Prism software (GraphPad Inc., La Jolla, CA, USA). P < 0.05 was considered statistically significant.


  Results Top


Dexamethasone induced apoptosis of osteoblasts in a dose- and time-dependent manner, while osteoclasts were not affected

In this study, we examined the effects of DEX in osteoblasts and osteoclasts separately. The MC3T3-E1 subclone 4 is a preosteoclast cell line that could be differentiated by β-glycerol phosphate and L-ascorbic acid. The differentiated cell is a commonly used osteoblast model.[9],[26] We verified the differentiation status of the osteoblast-like cells by ALP staining and the expression of osteocalcin. MC3T3-E1 induced for 7 days expressed significant level of ALP in high percentage compared to the untreated cells [Figure 1]a. As for the osteoclast, RAW264.7 subclone 2 is a commonly used macrophage cell line. When induced with receptor activator for NF-κB ligand (RANKL), the cell will be differentiated into osteoclast-like cell, and is also a well-recognized osteoclast cell model.[9],[27] TRAP staining was chosen for verifying the differentiation status of osteoclast-like cells. [Figure 1]b reveals that 6-day RANKL induction stimulates high differentiation of osteoclast-like cells. Our data revealed that the cells utilized in this study are highly differentiated and can represent the osteoblasts and osteoclasts. Standard systemic administration of DEX, through oral, peribulbar injection, and subconjunctival injection routes, produces the concentrations of DEX around 10−5–10−7 M in the circulation.[30] Although this concentration level only sustains in the first 4 h of a 24-h period due to the catabolism of DEX,[30] chronic treatment results in the accumulation of the cytotoxic events and causes osteoporosis. Accordingly, those concentrations of DEX were chosen for testing the cellular responses. The cell models utilized in this study included induced and differentiated MC3T3 cells and RANKL-differentiated RAW264.7 cells as osteoblasts and osteoclasts, respectively. MTT assay was performed to assess the osteoblast and osteoclast cell viability and proliferation when treated with different concentrations of DEX. In the osteoblast group, a decreasing trend of cell viability with an increasing dose of DEX was detected as shown in [Figure 1]c. At DEX concentrations of 10−7, 10−6, and 10−5 M, the decrease was not significant until the incubation lasted to 48 h. This dose- and time-dependent apoptosis is consistent with the clinical observations and previous reports from other research groups. In osteoclasts [Figure 1]d, the cell number is maintained in a steady level in the first 24 h, and cell proliferation will be promoted thereafter with 20% or more increase at 10−7, 10−6, and 10−5 M of DEX (P < 0.05). The results are consistent with those of previous observations that glucocorticoid promotes RANKL-mediated functions in the osteoclast and revealed opposite responses in those two types of cells. As both types of cells responded to DEX at the concentration of 10−5–10−7 M, we chose DEX at concentration of 10−6 for the following oxidative stress and mitochondrial assays.
Figure 1: Effects of dexamethasone on the proliferation of osteoblasts and osteoclasts. The differentiation status of osteoblasts and osteoclasts was examined by the staining of alkaline phosphatase (a) and tartrate-resistant acid phosphatase (b), respectively. Osteoblast cells (c) and osteoclast cells (d) were treated with 10−5, 10−6, 10−7, 10−8, and 10−9 M dexamethasone separately for 24 h and 48 h and examined as described in the materials and methods section. Controls received culture medium only. Each bar represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference from the control (P < 0.05)

Click here to view


Chronic incubation of high-dose glucocorticoid elevated reactive oxygen species in osteoblasts but not in osteoclasts

Glucocorticoid induces oxidative stress in various cell types, including osteoblasts. In addition, previous studies reported that oxidative stress is associated with GIO. The DEX-induced oxidative stress was characterized in osteoblasts or osteoclasts by measuring the ROS/RNS levels after DEX exposure with OxiSelect in vitro ROS/RNS assay Kit. This method employs a specific ROS/RNS fluorogenic probe (DCFH-DiOxyQ) that can detect H2O2, peroxyl radical, nitric oxide, and peroxynitrite anion with high sensitivity. These free radical molecules are representative of both ROS and RNS. Cells were homogenized, and the supernatants of cell lysates contained the total amount of intracellular free radicals in osteoblasts and osteoclasts, which were determined after DEX treatment. In the osteoblast group, the ROS/RNS levels did not significantly increase until 48 h of incubation with DEX [Figure 2]a. The period needed for the elevation of ROS/RNS levels is consistent with the induction of apoptosis by DEX, supporting the association between DEX-induced oxidative stress and apoptosis. In contrast, the osteoclast exhibits the opposite response that intracellular ROS/RNS dramatically decreased after 48 h of incubation [Figure 2]b. Notably, the intracellular levels of free radicals in untreated osteoblasts were higher than those in untreated osteoclasts, implying the different cell properties and antioxidant systems in those two cell types.
Figure 2: Measurement of dexamethasone-induced oxidative stress in osteoblasts and osteoclasts. Quantitative levels of reactive oxygen species and reactive nitrogen species measured in osteoblasts (a) and osteoclasts (b) after exposure to 10−6 M dexamethasone for 24 h and 48 h. Each column represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference between treatments where P < 0.05

Click here to view


Antioxidant genes were not upregulated in the glucocorticoid-treated osteoclasts

The actions and the efficiencies of the antioxidant system are important determinants of the generation and the elimination of cellular oxidative stress. It is not clear whether the antioxidant system is stimulated or suppressed by GR signaling. We examined the expression levels of three major antioxidant enzymes, namely SOD, CAT, and GPx. In osteoblasts, the expression of all the three genes was increased after 24 h of incubation, whereas the expressions of GPx and SOD were further elevated after longer incubation with DEX [Figure 3]a. The results indicated that the expression of all those genes is not inhibited by GR signaling. The upregulation of these genes could be the response to the increase of oxidative stress, or the effects of the GR actions. In the osteoclast, the expression of all the three genes remained unchanged [Figure 3]b. In addition, the ratios between the expression of those genes and internal control GAPDH in the osteoblast and osteoclast are comparable. We did not find evidence addressing that the antioxidant system in the osteoclast is more robust than that in the osteoblast.
Figure 3: Effects of dexamethasone on the antioxidant gene expression of osteoblasts and osteoclasts. The expression of antioxidative enzymes (catalase, glutathione peroxidase, and superoxide dismutase) after dexamethasone treatment in osteoblasts (a) and osteoclasts (b). Each column represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference between treatments where P < 0.05

Click here to view


Nitric oxide synthase was increased in dexamethasone-treated osteoblasts but decreased in osteoclasts

NO is an important source for intracellular oxidative stress. Previous studies also showed that NO has biphasic effects on regulating osteoblast survival and death.[23] It is not clear how GR signaling affects the actions and the expression of NOS. We discovered that the expression of nos2 gene was regulated by DEX in both cell types. The expression levels of nos2 gene in the osteoblast increase with time [Figure 4]a, whereas the opposite effects were detected in the osteoclast [Figure 4]b. The expression of NOS could be a cause of the ROS/RNS level differences.
Figure 4: Effects of dexamethasone on inducible nitric oxide synthase gene expression of osteoblasts and osteoclasts. The expression of inducible nitric oxide synthase after dexamethasone treatment in osteoblasts (a) and osteoclasts (b). Each column represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference between treatments where P < 0.05

Click here to view


Glucocorticoid-induced mitochondrial alterations observed in the osteoblast were not detected in the osteoclast

To understand the mitochondrial responses of osteoblast and osteoclast to DEX treatment, the Seahorse XF24 analyzer was employed to measure the metabolic flux of mitochondria. [Figure 5]a illustrates that osteoblasts exposed to DEX showed an enhanced metabolic phenotype, with an increasing trend in spare respiratory capacity, ATP production, proton leak, as well as increased basal and maximal respiratory capacity after 24 h of incubation. The increase of spare respiratory capacity and basal respiration indicates that the mitochondrial functions are upregulated by the action of glucocorticoids. However, the increase of the proton leak and the nonmitochondrial respiration implies the increase of ROS and possibly the damage of mitochondria. All the indexes reversed after 48 h of incubation, possibly due to the mitochondrial breakdown and cell death [Figure 5]b. Mitochondrial functions in the osteoclast were not affected by DEX treatment after 24 h of incubation [Figure 5]c. As the stimulation time lasted to 48 h, the spare respiratory capacity was decreased, but the ATP production was increased, suggesting that the mitochondrial functions were slightly affected after long-term incubation [Figure 5]d. On comparison, DEX induced greater and faster mitochondrial alterations in the osteoblast. The detrimental effects of DEX impair mitochondrial functions and integrity after chronic treatment. Alternatively, DEX did not induce immediate changes to mitochondrial actions.
Figure 5: The mitochondrial function was altered in osteoblasts treated with dexamethasone. The Seahorse XF24 analyzer was employed to determine the mitochondrial function of osteoblasts (a and b) and osteoclasts (c and d) exported to dexamethasone at 24 h and 48 h. Each column represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference between treatments where P < 0.05

Click here to view


Chronic incubation of high-dose glucocorticoid-induced mitochondrial breakdown in osteoblasts

To further identify the pathway through which DEX treatment altered apoptosis, the release of cytochrome C was analyzed by Western blot analysis. Compared with the control group, the mitochondrial release of cytochrome C was markedly increased in the osteoblast after long-term incubation [Figure 6]a, P < 0.05]. The cytosol maintained some low level of cytochrome C in the osteoclast [Figure 6]b, P > 0.05]. The accumulation of mitochondrial alterations induced by DEX breakdown the mitochondrial integrity in the osteoblast.
Figure 6: Detection of cytochrome C release in osteoblasts and osteoclasts by Western blot analysis. Immunoblots of rapidly separated pellets (mitochondria) and supernatants (cytosol) showed the release of cytochrome C evoked by dexamethasone which was time dependent in osteoblasts (a). The expression of cytochrome C remained the same level in both fractions of osteoclast after dexamethasone treatment (b). Each column represents the mean ± standard error of the mean of at least three independent experiments. *Significant difference between treatments where P < 0.05

Click here to view



  Discussion Top


Our experimental outcome revealed a few major discoveries. The first is that DEX induced mitochondrial alterations, including biphasic functional changes, impaired mitochondrial integrity, and cytochrome C release in osteoblasts. Glucocorticoids regulate mitochondrial functions through two different routes. At present of glucocorticoid, GRs formed a complex with the anti-apoptotic protein B-cell-lymphoma 2 (Bcl-2) and translocated with Bcl-2 into mitochondria in primary cortical neurons, they also upregulated mitochondrial calcium levels, membrane potential and oxidation.[31] These complex elevated mitochondrial calcium levels enhanced mitochondrial membrane potential and oxidation. In osteoblasts, after 24 h incubation with glucocorticoids, all measurements of the mitochondrial functions increased, including the ATP production and basal and maximal respiration capacity, suggesting that exposure to glucocorticoid enhances mitochondrial functions to provide cells with more energy for coping with and adapting to acute challenges [Figure 5]a. However, chronically elevated levels of glucocorticoids might reduce cell functioning via the decrease of interaction between GRs/Bcl-2 and mitochondria. Additionally, glucocorticoid-GR complex travels from cytoplasm to the nucleus to regulate gene expression by binding to glucocorticoid response element. The transcriptional alterations also influence cellular responses.

Our observations also provided possible molecular mechanisms of glucocorticoid-induced oxidative stress in osteoblasts. Multiple sources of cellular ROS/RNS have been reported.[32],[33],[34] Oxidative phosphorylation is the most common inducer of the cellular oxidative stress under physiological conditions.[32] Most cellular electrons that leak from the electron transport chain are reactive with oxygen in the mitochondria, producing superoxides. These superoxides are then converted to hydrogen peroxide in the mitochondria by the action of SOD. Additionally, DEX can indirectly induce oxidative stress through the depletion of antioxidant molecules or inhibition of antioxidant enzymes.[33],[34] There are also some reports of oxidative injury caused by increased lipid peroxidation and inhibition of key antioxidant enzymes in response to the high dose of DEX exposure.[35],[36] Nitrogen oxide (NO) is not only an important signaling molecule, but also an important source of oxidative stress. In vascular endothelial cells and cortical neurons, stimulation of glucocorticoids activates NOS and upregulates the expression of nos gene, leading to the elevation of cellular NO levels.[37],[38] In vivo, corticosterone is also shown to increase NOS levels.[39] Above lists, there are some of the potential mechanisms underlying the DEX-induced oxidative stress increase in the osteoblast [Figure 2]a. Our data revealed that antioxidant genes are not significantly altered until the ROS/RNS levels are significantly increased [Figure 2]a and the apoptosis become evident [Figure 1]c. The upregulation in the osteoblast and the downregulation of NOS reflect the fluctuation of ROS/RNS levels [Figure 2]a and [Figure 4]a. In contrast, biphasic effects on respiration rate and mitochondrial functions were observed [Figure 5]a. Incubation for 24 h increases the respiration rate in osteoblasts [Figure 5]a. The glucocorticoid-induced oxidative phosphorylation increase might be another source of oxidative stress in osteoblasts [Figure 5]a. The mitochondrial functions appear to be normal at this time point [Figure 5]a.

Another discovery is the very different cellular responses to glucocorticoid that are triggered in osteoclasts. Consistent with previous observations from other research groups, exogenous DEX treatment does not induce apoptosis in cultured osteoclasts.[40] In addition, the ROS/RNS levels are not elevated after glucocorticoid treatment [Figure 2]b. The different cellular responses might be due to two possible reasons: no significant mitochondrial alterations upon glucocorticoid treatment in the osteoclast, or a more robust antioxidant system in the osteoclast than in the osteoblast. Our results revealed that the mitochondrial activities and integrity remained unaltered upon stimulation [Figure 5]b. Furthermore, the expression of nos2 gene was not increased in the osteoclast [Figure 4]b. The elevated NO levels caused by increased inducible NOS (iNOS) activity are considered another major source of oxidative stress. In contrast, the expression of antioxidant genes is not significantly increased [Figure 3]b. Combining those results, the different susceptibility to exogenous glucocorticoids possibly arrives from different gene expression profiles and different cell properties, not different efficiency of the antioxidant system. Although the precise mechanisms are still unclear, the main event triggered by glucocorticoids seems to be a change in the balance between RANKL and osteoprotegerin.[41] RANKL acts as a key regulator of osteoclast recruitment, differentiation, activation, and survival, whereas osteoprotegerin, a decoy receptor for RANKL, inhibits its actions on osteoclasts. Thus, the balance between RANKL and osteoprotegerin is a central determinant of osteoclast-mediated bone resorption, and glucocorticoids switch this balance toward the activation of RANKL. Glucocorticoids also cause an increase in the production of macrophage colony-stimulating factor, another factor crucial for osteoclastogenesis.[42] There is also evidence that glucocorticoids directly prolong the lifespan of mature osteoclasts.[43] Paradoxically, glucocorticoid is a potent anti-inflammatory agent that inhibits the activation of macrophages. It is not clear whether the activation of osteoclast and bone resorption is inhibited, similar with the macrophages, or enhanced by glucocorticoids. The inhibition of nos2 gene expression agrees with the inhibition hypothesis [Figure 4]b. But the actually status of osteoclast activation and bone resorption needs to be further examined.

In addition, the actions of glucocorticoids on bone and mineral metabolism are strongly dose and time dependent. Endogenous glucocorticoids are key regulators of mesenchymal cell differentiation and bone development at physiological concentrations.[44],[45] Conversely, high dose of glucocorticoid treatment increases intracellular oxidative stress in various types of cells, including osteoblasts, hippocampal neurons, vascular endothelial cells, thymocytes, and myeloma cells.[33],[35],[36],[37],[46],[47] Incubation of cortical neurons with corticosterone increased mitochondrial oxidation in a dose- and time-dependent manner.[38] ROS scavenger NAC and GR antagonist RU 486 prevent the DEX-induced oxidative stress and apoptosis in the cultured cortical neurons, indicating that glucocorticoids have direct effects on GR-mediated transcription regulation.[33],[38] Osteoblasts exhibit similar response to DEX treatment. Only high concentrations of DEX (10−5–10−7 M) and long-term incubation (48 h) trigger cell death and oxidative stress [Figure 1]c and [Figure 2]a. Notably, the cytotoxic concentration matches the clinical observations. In addition, the gradual increase of oxidative stress is consistent with the incidence of apoptosis, suggesting that oxidative stress might be an important risk factor of DEX-induced apoptosis.

In this study, we utilized in vitro osteoblast-like and osteoclast-like cell models. The pros and cons of using those cell models are obvious: the advantage of those models is that it is easy to study the cellular and molecular events in the homogeneous cell populations. However, even though those cells have been recognized as the ideal cell models of osteoblasts and osteoclasts, there are still differences with osteoblasts and osteoclasts de novo. Therefore, a similar study will be performed in primary osteoblasts and osteoclasts or in an in vivo system in future.

Bone metabolism is a lifelong dynamic process where bone resorption and bone formation simultaneously occur and regulate with each other to reach a homeostasis.[48],[49] Osteoporosis could be the result of excessive bone resorption which leads to loss of bone mass and disruption of architecture, or failure to replace the lost bone due to defects in bone formation. Our observations indicate that the imbalance of the bone modeling induced by excess glucocorticoids mainly results in cell death of osteoblasts and decrease of bone formation, not the elevation of bone resorption. Although a proliferation of osteoclasts was observed, the suppressed nos2 gene expression and the unaltered respiration rates and mitochondrial functions suggest that activation of osteoclasts might not be increased. Previous studies suggested that GIO is the result of suppression of osteoblast activity and bone formation, and also the increase of osteoclast activation and bone resorption.[10],[22] iNOS is generally considered a pro-inflammatory agent and M1 marker in macrophage. Our results suggest that antioxidants or the ROS/RNS scavengers might be potential medications for prevention or treating GIO.

Financial support and sponsorship

This study was financially supported by Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan, Taiwan, (PTH108039).

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Shi XM, Chutkan N, Hamrick MW, Isales CM. Mechanism of Glucocorticoid-Induced Osteoporosis: An Update. Glucocorticoids-New Recognition of Our Familiar Friend: Intech; 2012.  Back to cited text no. 1
    
2.
Sarinho ES, Melo VM. Glucocorticoid-induced bone disease: Mechanisms and importance in pediatric practice. Rev Paul Pediatr 2017;35:207-15.  Back to cited text no. 2
    
3.
Fraser LA, Adachi JD. Glucocorticoid-induced osteoporosis: Treatment update and review. Ther Adv Musculoskelet Dis 2009;1:71-85.  Back to cited text no. 3
    
4.
Hsu E, Nanes M. Advances in treatment of glucocorticoid-induced osteoporosis. Curr Opin Endocrinol Diabetes Obes 2017;24:411-7.  Back to cited text no. 4
    
5.
Buehring B, Viswanathan R, Binkley N, Busse W. Glucocorticoid-induced osteoporosis: An update on effects and management. J Allergy Clin Immunol 2013;132:1019-30.  Back to cited text no. 5
    
6.
Cosman F, de Beur SJ, LeBoff MS, Lewiecki EM, Tanner B, Randall S, et al. Clinician's guide to prevention and treatment of osteoporosis. Osteoporos Int 2014;25:2359-81.  Back to cited text no. 6
    
7.
Raggatt LJ, Partridge NC. Cellular and molecular mechanisms of bone remodeling. J Biol Chem 2010;285:25103-8.  Back to cited text no. 7
    
8.
Eriksen EF. Cellular mechanisms of bone remodeling. Rev Endocr Metab Disord 2010;11:219-27.  Back to cited text no. 8
    
9.
Owen R, Reilly GC.In vitro models of bone remodelling and associated disorders. Front Bioeng Biotechnol 2018;6:134.  Back to cited text no. 9
    
10.
Seibel MJ, Cooper MS, Zhou H. Glucocorticoid-induced osteoporosis: Mechanisms, management, and future perspectives. Lancet Diabetes Endocrinol 2013;1:59-70.  Back to cited text no. 10
    
11.
Gruver-Yates AL, Cidlowski JA. Tissue-specific actions of glucocorticoids on apoptosis: A double-edged sword. Cells 2013;2:202-23.  Back to cited text no. 11
    
12.
Weinstein RS, Jilka RL, Parfitt AM, Manolagas SC. Inhibition of osteoblastogenesis and promotion of apoptosis of osteoblasts and osteocytes by glucocorticoids. Potential mechanisms of their deleterious effects on bone. J Clin Invest 1998;102:274-82.  Back to cited text no. 12
    
13.
Plotkin LI, Weinstein RS, Parfitt AM, Roberson PK, Manolagas SC, Bellido T. Prevention of osteocyte and osteoblast apoptosis by bisphosphonates and calcitonin. J Clin Invest 1999;104:1363-74.  Back to cited text no. 13
    
14.
Sato AY, Tu X, McAndrews KA, Plotkin LI, Bellido T. Prevention of glucocorticoid induced-apoptosis of osteoblasts and osteocytes by protecting against endoplasmic reticulum (ER) stress in vitro and in vivo in female mice. Bone 2015;73:60-8.  Back to cited text no. 14
    
15.
O'Brien CA, Jia D, Plotkin LI, Bellido T, Powers CC, Stewart SA, et al. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology 2004;145:1835-41.  Back to cited text no. 15
    
16.
Hirayama T, Sabokbar A, Athanasou NA. Effect of corticosteroids on human osteoclast formation and activity. J Endocrinol 2002;175:155-63.  Back to cited text no. 16
    
17.
Manolagas SC. Corticosteroids and fractures: A close encounter of the third cell kind. J Bone Miner Res 2000;15:1001-5.  Back to cited text no. 17
    
18.
Hamouda S, Yasear A. Effect of dexamethasone on osteoclast formation in the alveolar bone of rabbits. Iraqi J Vet Sci 2009;23:13-6.  Back to cited text no. 18
    
19.
Johnson TE, Vogel R, Rutledge SJ, Rodan G, Schmidt A. Thiazolidinedione effects on glucocorticoid receptor-mediated gene transcription and differentiation in osteoblastic cells. Endocrinology 1999;140:3245-54.  Back to cited text no. 19
    
20.
Zhang W, Yang N, Shi XM. Regulation of mesenchymal stem cell osteogenic differentiation by glucocorticoid-induced leucine zipper (GILZ). J Biol Chem 2008;283:4723-9.  Back to cited text no. 20
    
21.
Jeon MJ, Kim JA, Kwon SH, Kim SW, Park KS, Park SW, et al. Activation of peroxisome proliferator-activated receptor-gamma inhibits the Runx2-mediated transcription of osteocalcin in osteoblasts. J Biol Chem 2003;278:23270-7.  Back to cited text no. 21
    
22.
Rauch A, Seitz S, Baschant U, Schilling AF, Illing A, Stride B, et al. Glucocorticoids suppress bone formation by attenuating osteoblast differentiation via the monomeric glucocorticoid receptor. Cell Metab 2010;11:517-31.  Back to cited text no. 22
    
23.
Almeida M, Han L, Ambrogini E, Weinstein RS, Manolagas SC. Glucocorticoids and tumor necrosis factor α increase oxidative stress and suppress Wnt protein signaling in osteoblasts. J Biol Chem 2011;286:44326-35.  Back to cited text no. 23
    
24.
Feng YL, Tang XL. Effect of glucocorticoid-induced oxidative stress on the expression of cbfa1. Chem Biol Interact 2014;207:26-31.  Back to cited text no. 24
    
25.
Yamada M, Tsukimura N, Ikeda T, Sugita Y, Att W, Kojima N, et al. N-acetyl cysteine as an osteogenesis-enhancing molecule for bone regeneration. Biomaterials 2013;34:6147-56.  Back to cited text no. 25
    
26.
Ding LZ, Teng X, Zhang ZB, Zheng CJ, Chen SH. Mangiferin inhibits apoptosis and oxidative stress via BMP2/Smad-1 signaling in dexamethasone-induced MC3T3-E1 cells. Int J Mol Med 2018;41:2517-26.  Back to cited text no. 26
    
27.
Hou GQ, Guo C, Song GH, Fang N, Fan WJ, Chen XD, et al. Lipopolysaccharide (LPS) promotes osteoclast differentiation and activation by enhancing the MAPK pathway and COX-2 expression in RAW264.7 cells. Int J Mol Med 2013;32:503-10.  Back to cited text no. 27
    
28.
Han D, Gao J, Gu X, Hengstler JG, Zhang L, Shahid M, et al. P21Waf1/Cip1 depletion promotes dexamethasone-induced apoptosis in osteoblastic MC3T3-E1 cells by inhibiting the Nrf2/HO-1 pathway. Arch Toxicol 2018;92:679-92.  Back to cited text no. 28
    
29.
Guntur AR, Gerencser AA, Le PT, DeMambro VE, Bornstein SA, Mookerjee SA, et al. Osteoblast-like MC3T3-E1 cells prefer glycolysis for ATP production but adipocyte-like 3T3-L1 cells prefer oxidative phosphorylation. J Bone Miner Res 2018;33:1052-65.  Back to cited text no. 29
    
30.
Weijtens O, Feron EJ, Schoemaker RC, Cohen AF, Lentjes EG, Romijn FP, et al. High concentration of dexamethasone in aqueous and vitreous after subconjunctival injection. Am J Ophthalmol 1999;128:192-7.  Back to cited text no. 30
    
31.
Du J, Wang Y, Hunter R, Wei Y, Blumenthal R, Falke C, et al. Dynamic regulation of mitochondrial function by glucocorticoids. Proc Natl Acad Sci U S A 2009;106:3543-8.  Back to cited text no. 31
    
32.
Ott M, Gogvadze V, Orrenius S, Zhivotovsky B. Mitochondria, oxidative stress and cell death. Apoptosis 2007;12:913-22.  Back to cited text no. 32
    
33.
You JM, Yun SJ, Nam KN, Kang C, Won R, Lee EH. Mechanism of glucocorticoid-induced oxidative stress in rat hippocampal slice cultures. Can J Physiol Pharmacol 2009;87:440-7.  Back to cited text no. 33
    
34.
Zhou W, Quan JH, Lee YH, Shin DW, Cha GH. Toxoplasma gondii proliferation require down-regulation of host Nox4 expression via activation of PI3 kinase/Akt signaling pathway. PLoS One 2013;8:e66306.  Back to cited text no. 34
    
35.
Bera S, Greiner S, Choudhury A, Dispenzieri A, Spitz DR, Russell SJ, et al. Dexamethasone-induced oxidative stress enhances myeloma cell radiosensitization while sparing normal bone marrow hematopoiesis. Neoplasia 2010;12:980-92.  Back to cited text no. 35
    
36.
Qiao S, Okret S, Jondal M. Thymocyte-synthesized glucocorticoids play a role in thymocyte homeostasis and are down-regulated by adrenocorticotropic hormone. Endocrinology 2009;150:4163-9.  Back to cited text no. 36
    
37.
Iuchi T, Akaike M, Mitsui T, Ohshima Y, Shintani Y, Azuma H, et al. Glucocorticoid excess induces superoxide production in vascular endothelial cells and elicits vascular endothelial dysfunction. Circ Res 2003;92:81-7.  Back to cited text no. 37
    
38.
Behl C, Lezoualc'h F, Trapp T, Widmann M, Skutella T, Holsboer F, et al. Glucocorticoids enhance oxidative stress-induced cell death in hippocampal neurons in vitro. Endocrinology 1997;138:101-6.  Back to cited text no. 38
    
39.
Khanduja KL, Kaushik G, Khanduja S, Pathak CM, Laldinpuii J, Behera D. Corticosteroids affect nitric oxide generation, total free radicals production, and nitric oxide synthase activity in monocytes of asthmatic patients. Mol Cell Biochem 2011;346:31-7.  Back to cited text no. 39
    
40.
Takuma A, Kaneda T, Sato T, Ninomiya S, Kumegawa M, Hakeda Y. Dexamethasone enhances osteoclast formation synergistically with transforming growth factor-beta by stimulating the priming of osteoclast progenitors for differentiation into osteoclasts. J Biol Chem 2003;278:44667-74.  Back to cited text no. 40
    
41.
Kearns AE, Khosla S, Kostenuik PJ. Receptor activator of nuclear factor kappaB ligand and osteoprotegerin regulation of bone remodeling in health and disease. Endocr Rev 2008;29:155-92.  Back to cited text no. 41
    
42.
Sivagurunathan S, Muir MM, Brennan TC, Seale JP, Mason RS. Influence of glucocorticoids on human osteoclast generation and activity. J Bone Miner Res 2005;20:390-8.  Back to cited text no. 42
    
43.
Jia D, O'Brien CA, Stewart SA, Manolagas SC, Weinstein RS. Glucocorticoids act directly on osteoclasts to increase their life span and reduce bone density. Endocrinology 2006;147:5592-9.  Back to cited text no. 43
    
44.
Zhou H, Cooper MS, Seibel MJ. Endogenous glucocorticoids and bone. Bone Res 2013;1:107-19.  Back to cited text no. 44
    
45.
Hachemi Y, Rapp AE, Picke AK, Weidinger G, Ignatius A, Tuckermann J. Molecular mechanisms of glucocorticoids on skeleton and bone regeneration after fracture. J Mol Endocrinol 2018;61:R75-90.  Back to cited text no. 45
    
46.
Sato H, Takahashi T, Sumitani K, Takatsu H, Urano S. Glucocorticoid generates ROS to induce oxidative injury in the hippocampus, leading to impairment of cognitive function of rats. J Clin Biochem Nutr 2010;47:224-32.  Back to cited text no. 46
    
47.
Maio R, Perticone M, Sciacqua A, Tassone EJ, Naccarato P, Bagnato C, et al. Oxidative stress impairs endothelial function in nondipper hypertensive patients. Cardiovasc Ther 2012;30:85-92.  Back to cited text no. 47
    
48.
Datta HK, Ng WF, Walker JA, Tuck SP, Varanasi SS. The cell biology of bone metabolism. J Clin Pathol 2008;61:577-87.  Back to cited text no. 48
    
49.
Siddiqui JA, Partridge NC. Physiological bone remodeling: Systemic regulation and growth factor involvement. Physiology (Bethesda) 2016;31:233-45.  Back to cited text no. 49
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed420    
    Printed26    
    Emailed0    
    PDF Downloaded83    
    Comments [Add]    

Recommend this journal