• Users Online: 129
  • Print this page
  • Email this page

 
Table of Contents
ORIGINAL ARTICLE
Year : 2020  |  Volume : 63  |  Issue : 6  |  Page : 286-293

Glucocorticoid transiently upregulates mitochondrial biogenesis in the osteoblast


1 Department of Orthopedics, Taoyuan General Hospital, Ministry of Health and Welfare; Graduate School of Biotechnology and Bioengineering, Yuan Ze University, Taoyuan, Taiwan
2 Department of Surgery, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan, Taiwan
3 Department of Orthopedics, Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan; Department of Biology and Anatomy, National Defense Medical Center, Taipei, Taiwan
4 Department of Animal Science, National Pingtung University of Science and Technology, Pingtung, Taiwan
5 Department of Animal Science and Technology; Institute of Biotechnology, National Taiwan University, Taipei, Taiwan
6 Graduate School of Biotechnology and Bioengineering; Department of Chemical Engineering and Materials Science, Yuan Ze University, Taoyuan, Taiwan

Date of Submission29-Jun-2020
Date of Decision12-Nov-2020
Date of Acceptance16-Nov-2020
Date of Web Publication26-Dec-2020

Correspondence Address:
Dr. Chao-Ling Yao
Department of Chemical Engineering and Materials Science, Yuan Ze University, Taoyuan
Taiwan
Dr. Shao-Yu Peng
Department of Animal Science, National Pingtung University of Science and Technology, Pingtung
Taiwan
Prof. Shinn-Chih Wu
Institute of Biotechnology, National Taiwan University, Taipei; Institute of Animal Science and Technology, National Taiwan University, Taipei
Taiwan
Login to access the Email id

Source of Support: None, Conflict of Interest: None


Read associated with this article

DOI: 10.4103/CJP.CJP_51_20

Rights and Permissions
  Abstract 


Glucocorticoid (GC)-induced bone loss is the most prevalent form of secondary osteoporosis. Previous studies demonstrated that long-term incubation of dexamethasone (DEX) induced oxidative stress and mitochondrial dysfunctions, consequently leading to apoptosis of differentiated osteoblasts. This DEX-induced cell death might be the main causes of bone loss. We previously described that DEX induced biphasic mitochondrial alternations. As GC affects mitochondrial physiology through several different possible routes, the short-term and long-term effects of GC treatment on mitochondria in the osteoblast have not been carefully characterized. Here, we examined the expression levels of genes that are associated with mitochondrial functions at several different time points after incubation with DEX. Mitochondrial biogenesis-mediated genes nuclear respiratory factor 1 (Nrf1) and Nrf2 were upregulated after 4-h incubation, and then declined after 24-h incubation, suggesting that mitochondrial biogenesis were transiently upregulated by DEX. In contrast, mitochondrial fusion gene optic atrophy 1 (Opa1) and mitofusin 2 (Mfn2) started to be elevated as the biogenesis started to decrease. Finally, the mitochondrial fission increased and apoptosis becomes prominent. Agree with the mitochondrial biphasic alterations hypothesis, the results suggested an early increase of mitochondrial activities and biogenesis upon DEX stimulation to the osteoblasts. The oxidative phosphorylation and inducible nitric oxide synthase levels increased results in oxidative stress accumulation, leading to mitochondrial fusion, and subsequently fission and triggering the apoptosis. Our results indicated that the primary effects of GC on mitochondria are promoting their functions and biogenesis. Mitochondrial breakdown and the activation of the apoptotic pathways appeared to be the secondary effect after long-term treatment.

Keywords: Glucocorticoid, mitochondrial biogenesis, mitochondrial fission, mitochondrial fusion, osteoblast


How to cite this article:
Hsu CN, Jen CY, Chen YH, Peng SY, Wu SC, Yao CL. Glucocorticoid transiently upregulates mitochondrial biogenesis in the osteoblast. Chin J Physiol 2020;63:286-93

How to cite this URL:
Hsu CN, Jen CY, Chen YH, Peng SY, Wu SC, Yao CL. Glucocorticoid transiently upregulates mitochondrial biogenesis in the osteoblast. Chin J Physiol [serial online] 2020 [cited 2021 Jun 22];63:286-93. Available from: https://www.cjphysiology.org/text.asp?2020/63/6/286/304858

Chien-Ning Hsu, Chih-Yuan Jen, Yu-Hsu Chen are Co-First authors





  Introduction Top


Glucocorticoids alter the mitochondria functions and increase reactive oxygen species. Glucocorticoids (GCs) are steroid hormones with pleiotropic effects on a numerous physiological process. Cellular responses to GC treatment are remarkably diverse, exhibiting profound variability in specificity and sensitivity, possibly due to the varied expression of cofactors and glucocorticoid receptor (GR) isoforms in different cell types.[1] The osteoblast differentiation is inhibited by GC through the induction of adipogenic transcription factors (peroxisome proliferator-activated receptor-gamma [PPARγ]) and suppression of Wnt signaling.[2],[3],[4] A high dose of GC elevates osteoblast and osteocyte apoptosis. One possible mechanism underlying this phenomenon is through increasing oxidative stress. Administration of prednisolone to mice increased reactive oxygen species (ROS) in the bone.[5] The generation of ROS by dexamethasone (DEX) was responsible for the activation of c-Jun N-terminal kinase (JNK) and induction of apoptosis in the cultured osteoblast. In addition, DEX induces oxidative damages in the osteoblast, including depletion in total antioxidant capacity, increased ROS formation, and enhanced lipid peroxidation.[6] Antioxidant N-acetylcysteine attenuates the DEX-induced cytotoxic effects in the osteoblast.[7] Our previous interesting findings demonstrated the biphasic effects of exogenous GC on osteoblastic mitochondrial functions and elevated intracellular oxidative stress in a dose- and time-dependent manner.[8] We further revealed that GC has a substantial impact on the osteoblastic mitochondria. Basal respiration rate and adenosine triphosphate (ATP) production were increased upon 24-h incubation of GC. The increase of proton leak and nonmitochondrial respiration suggests a potential source of GC-induced oxidative stress. The accumulation of these detrimental changes results in cytochrome C release and mitochondrial breakdown, consequently leading to apoptosis. Our observations suggested that the mitochondrial alterations might be a major source of GC-induced oxidative stress in the osteoblast and could be critical for GC-induced apoptosis. However, the biphasic effects of GC treatment on mitochondria in the osteoblast have not been characterized.

GCs could mediate the genomic and nongenomic effects, GC affects the mitochondria possibly through several different routes. Most of the GC actions are the results of their genomic effects mediated by the ligand-induced nuclear translocation of the cytoplasmic GRs leading to the transcriptional activation or repression of numerous genes.[9],[10],[11] Some of the GC-induced genes are important mitochondrial regulating genes, such as PCG1a.[12] It is possible that the upregulation of these genes influences mitochondrial functions or status. In addition, ligand-activated GR also possibly binds and regulates the activities of other effector proteins in the cytoplasm. GC-GR involves nonnuclear actions such as rapid endothelial nitrogen oxide synthase activation or alterations in signaling events and effector mechanisms of the cells;[13] for example, the interaction of the activated GR with cytoplasmic proteins like nuclear factor-kappa B[11] or with molecules of the T-cell receptor signaling pathway like lymphocyte-specific protein tyrosine kinase, Fyn,[14] and zeta-chain-associated protein kinase 70 kDa.[15] The third nongenomic GC action is the translocation of GR to the mitochondria, which correlates to the sensitivity of a given cell type to GC-induced apoptosis.[16],[17] The GC-induced mitochondrial apoptotic pathway leads to the disruption of the mitochondrial membrane potential and the release of key apoptosis-inducing factors like cytochrome C.[16],[18] Whether GR-independent routes are involved in the mitochondrial alterations remains inconclusive.

GCs alter the mitochondria function through the genomic effects in bone. We characterized the mitochondrial alteration by examining the expression levels of genes that are associated or regulate the mitochondrial functions at several different time points. Based on the results, we can depict the mitochondrial alterations with time and hopefully figure out the detailed molecular mechanisms underlying GC-induced osteoblast apoptosis.


  Materials and Methods Top


Cell culture and treatment

The murine preosteoblastic calvarial cell line MC3T3-E1 subclone 4 was obtained from ATCC (ATCC® CRL-2593™). Cells were cultured in Minimum Essential Medium Eagle-Alpha Modification (α-MEM) (Gibco, Thermo Fisher Scientific, Inc., USA, Cat No. 10490-01) supplemented with 10% fetal bovine serum (FBS) (Gibco, Thermo Fisher Scientific, Inc., USA, Cat No. 10437-028) and 1% P/S (Gibco, Thermo Fisher Scientific, Inc., USA, Cat No. 15140-122) at 37°C in a humidified atmosphere containing 5% CO2. To obtain osteoblasts, MC3T3-E1 cells were grown for 7 days α-MEM containing 1% FBS, 1% P/S, 10 mM β-glycerol phosphate (Sigma-Aldrich, USA, Cat No. G9422), and 50 ug/ml L-ascorbic acid (Sigma-Aldrich, USA, Cat No. A5960).[19],[20]

Reverse transcription-quantitative polymerase chain reaction assay

Total RNA was extracted using RNAzol® reagent (Mrcgene; Molecular research center, Inc., USA, Cat No. RB192) according to the manufacturer's protocol. cDNA was synthesized using an IQ2 MMLV RT-Script kit (Bio-Genesis Technologies Inc., USA) according to the manufacturer's protocol. Quantitative polymerase chain reaction (qPCR) was performed using SYBR Green (Applied Biosystems, Thermo Fisher Scientific, Inc., USA, Cat No. A25742), and data collection was conducted using an ABI 7300 (Applied Biosystems, Thermo Fisher Scientific, Inc., USA). The PCR cycling conditions were listed as following: 95°C for 2 min, followed by 40 cycles at 95°C for 20 s, 53°C for 20 s and 72°C for 40 s, a final extension step of 95°C for 15 s, 60°C for 1 min, 95°C for 15 s and 60°C for 15 s.[19] Primer sequences were as follow:

  • ND1, forward 5'-TCGACCTGACAGAAGGAGAATCA-3' and reverse 5'-GGGCCGGCTGCGTATT-3'
  • COX1, forward 5'-TTTTCAGGCTTCACCCTAGATGA-3' and reverse 5'-AAGAATGTTATGTTTACTCCTACGAATATG-3'
  • Opa1, forward 5'-CCTTTGTCGCAGAGGTTTTTATTAC-3' and reverse 5'-CATTGCATTCAGCTCAGAATC-3'
  • Drp1, forward 5'-TTAGTGGCAATTGAGCTAGCGTAT-3' and reverse 5'-CCCACAGGCATCAGCAAAGT-3'
  • Fis1, forward 5'-TGGTGTCTGTGGAGGATCTG-3' and reverse 5'-ATTGCGTGCTCTTGGACAC-3'
  • Mfn2, forward 5'-CGAGGCTCTGGATTCACTTCA-3' and reverse 5'-CCAACCAGCCAGCTTTATTCC-3'
  • Nrf1, forward 5'-ACAGCAGTGGCAAGATCTCA-3' and reverse 5'-GCAAGGCTGTAGTTGGTGCT-3'
  • Nrf2, forward 5'-CAAGACTTGGGCCACTTAAAAGAC-3' and reverse 5'-AGTAAGGCTTTCCATCCTCATCAC-3'
  • GAPDH, forward 5'- GCACAGTCAAGGCCGAGAAT-3' and reverse 5'- GCCTTCTCCATGGTGGTGAA -3'.


GAPDH was used as an internal control for normalization. Gene expression was calculated using the 2-ΔΔCq method.

MitoTracker green stain and image analysis

MitoTracker® Green FM (Invitrogen, USA, Cat No. M7514) was used to visualize mitochondria. After incubation with MitoTracker (40 nM diluted in culture medium, 30 min, 37°C), the cells were washed three times with culture medium. Live cell imaging was monitored by DeltaVision imaging system (PersonalDV, GE Healthcare) using an inverted epifluorescence microscope (IX-71, Olympus) with a charge-coupled device camera (CoolSNAP ES2, Photometrics). Photographs were taken independently using constant camera exposure settings. The level of cellular fluorescence from fluorescence microscope images was determined by ImageJ (This method was contributed by Luke Hammond, QBI, The University of Queensland, Australia). Please see the website (https://theolb.readthedocs.io/en/latest/imaging/measuring-cell-fluorescence-using-imagej.html) for the details. The formula to calculate the corrected total cell fluorescence (CTCF) is CTCF = Integrated density − (Area of selected cell × mean fluorescence of background readings).

Statistical analysis

All data are presented as the means ± standard error and are representative of experiments conducted in triplicate. Statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc., La Jolla, CA, USA). Multiple t-tests were used to compare data from the control and DEX-treated groups. Symbols were considered to indicate a statistically significant difference (*where P < 0.05, **where P < 0.002, ***where P < 0.0002, ****where P < 0.0001).


  Results Top


Short-term dexamethasone treatment does not disrupt mitochondrial functions in the osteoblast

Previous studies suggested that DEX-induced apoptosis in the osteoblast possibly through mitochondrial routes such as cytochrome C release. Alternatively, our previous results demonstrated that DEX caused the biphasic effect in regulating mitochondrial function of osteoblasts.[8] Mitochondrial respiration and ATP production in the osteoblasts elevated after 24 h of incubation, implying that DEX treatment does not disturb mitochondrial function. The apoptosis induced by the exogenous DEX might be the secondary effects of the increases of mitochondrial respiration and oxidative phosphorylation. We analyzed the expression of two mitochondrial genes that are essential for oxidative respiration to evaluate the mitochondrial functions: ND1 (a subunit of NADH dehydrogenase and a key enzyme to regulate electron transferring) and COX1 (a main subunit of the COX1 complex and a key enzyme in aerobic metabolism). [Figure 1]a reveals that the increase of the ND1 gene expression started from 12 h after DEX treatment. In contrast, DEX caused the upregulation of COX1 gene from 4 h after DEX treatment and reached the peak 8 h later [Figure 1]b. The expression of both genes remained at high levels throughout the 48 h of analysis. These results suggest that the DEX exposure does not negatively regulate mitochondrial functions, even when the apoptotic events become evident.
Figure 1: Mitochondrial genes upregulated shortly after dexamethasone treatment in osteoblast. The expression of mitochondrial genes ND1 (a) and cytochrome C oxidase I (b) after dexamethasone treatment (10-6 M) in osteoblast at 4, 12, 24, and 48 h, respectively. Each column represents the mean ± standard error of the mean of at least three independent experiments. Symbols indicate a significant difference between treatment with and without dexamethasone (*where P < 0.05, **where P < 0.002, ***where P < 0.0002).

Click here to view


Exogenous dexamethasone transiently upregulated mitochondrial biogenesis in the osteoblast

GC + GR complex transcriptionally regulates several genes that are crucial for modulating mitochondrial dynamics, such as PPARγ and its cofactor peroxisome proliferator-activated receptor-gamma coactivator-1alpha (PGC-1α).[12],[21] GCs are among the most potent inducers of PGC-1α expression.[12] Both genes are essential positive regulators of mitochondrial biogenesis. Therefore, we predicted that DEX treatment promotes mitochondrial biogenesis. Nrf1 and Nrf2 are important contributors to the sequence of events leading to the increase in transcription of key mitochondrial enzymes, including respiratory complexes, mtDNA transcription, and replication machinery, and consequently promote biogenesis.[22],[23] Both genes are downstream targets of PGC-1α. We examined the expression of Nrf1 and Nrf2 in the differentiated osteoblasts treated with DEX at 4, 12, 24, and 48 h [Figure 2]a and [Figure 2]b. The expression of Nrf1 was upregulated starting from 12-h incubation of DEX, while the expression of Nrf2 elevated earlier, starting from 4 h after treatment. The expression of both genes came back to the control level at 48 h. These results indicated that the mitochondrial biogenesis was transiently upregulated during the DEX exposure, and this change was not lasted as the oxidative stress accumulated and the mitochondria started to breakdown.
Figure 2: Mitochondrial biogenesis-mediated genes transiently upregulated in osteoblast after dexamethasone treatment. Quantitative levels of mitochondrial biogenesis-mediated genes nuclear respiratory factor 1 (a) and nuclear respiratory factor 2 (b) expression were measured by quantitative polymerase chain reaction in osteoblasts after exposure to 10-6 M dexamethasone for 4, 12, 24, and 48 h. Each column represents the mean ± standard error of the mean of at least three independent experiments. Symbols indicate a significant difference between treatment with and without dexamethasone (*where P < 0.05, ****where P < 0.0001).

Click here to view


High level of dexamethasone mediates increases of mitochondrial contents in the osteoblast

Mitochondrial biogenesis is the growth and division of preexisting mitochondria and causing an increase of mitochondrial mass. To visualize the increase of mitochondrial content, we further analyzed the mitochondrial morphological changes in the osteoblasts under DEX treatment by MitoTracker, which is a cell-permeable probe containing a mildly thiol-reactive chloromethyl moiety for mitochondrial labeling. Mitochondrial staining was performed at four different time points: 4, 12, 24, or 48 h. Mitochondrial mass was calculated by the signal intensity in one cell. As shown in [Figure 3], the mitochondrial mass was increased and reached a peak at 12 h after DEX treatment. The increase was attenuated afterward and returned to basal levels 2 days after treatment. The organelle appeared to be more aggregated surrounding the nucleus after 24 h of incubation. These observations are consistent with our finding that DEX promoted mitochondrial biogenesis [Figure 2]a and [Figure 2]b.
Figure 3: The density of mitochondria increased in osteoblast after DEX treatment. The mitochondrial morphology of osteoblast was evaluated by MitoTracker staining. Osteoblasts were seeded and treated with DEX (10-6 M) for 4, 12, 24 and 48 h, and subjected to the assay. Scale bar = 20 μm. Symbols indicate a significant difference between treatment with and without DEX (** where P < 0.002, **** where P < 0.0001). DEX: Dexamethasone.

Click here to view


Dexamethasone treatment induces mitochondrial fusion subsequent to the elevation of mitochondrial biogenesis in osteoblasts

Mitochondria are highly versatile and very easy to change the shape through fission and fusion events.[24] It is well known that the processes of mitochondrial fission/fusion are controlled by GTPase.[25] The mitochondrial fusion is the event of two or more entities joining to form a whole and generates extended mitochondrial networks. This event is mediated by Opa1 and Mfn1 and Mfn2 and is very important in respiratory active cells that enable the spreading of metabolites, enzymes, and mitochondrial gene products throughout the entire mitochondrial compartment.[26] Previous studies suggested that fusion and fission events are negatively correlated. Accordingly, we predicted that the fission event is downregulated. Here, we evaluated how mitochondrial fusion-related genes (Opa1 and Mfn2) contribute to mitochondrial function in DEX-treated osteoblasts. The expressions of both genes were determined by qPCR. The expression levels of Opa1 were increased starting from 12 h after treatment and maintained the upregulation levels until 1-day DEX exposure [Figure 4]a. The mRNA levels of Mfn2 were also increased starting from 12 h after treatment and maintained in upregulated levels until 2 days after DEX exposure [Figure 4]b. The mitochondrial dynamics were also illustrated by MitoTracker staining. The average length of mitochondria appeared the trend of elongation in the 1st day of DEX incubation, indicating that the fusion/fission ratio was temporarily increased [Figure 4]c. The result is consistent with the elevation of mitochondrial fusion genes.
Figure 4: Delayed appearance of mitochondrial fusion genes in osteoblast after dexamethasone treatment. The expression of mitochondrial fusion genes Opa1 (a) and mitofusin 2 (b) after dexamethasone treatment (10-6 M) in osteoblast at 4, 12, 24, and 48 h, respectively. The mitochondrial morphology of osteoblast was evaluated by MitoTracker staining after dexamethasone treatment (10-6 M) in osteoblast at 12 and 24 h (c). Scale bar = 10 μm. Each column represents the mean ± standard error of the mean of at least three independent experiments. Symbols indicate a significant difference between treatment with and without dexamethasone (*where P < 0.05, **where P < 0.002, ****where P < 0.0001).

Click here to view


Long-term incubation of dexamethasone leads to mitochondrial fission in the osteoblasts

Mitochondrial fission, fusion, and biogenesis play an important role in maintaining mitochondrial homeostasis. Mitochondrial fission is the event of a single entity breaking apart, and fragmented mitochondria are frequently found in resting cells. Mitochondrial fission plays an important role in the removal of damaged organelles by autophagy, and this event is driven by Drp1 and Fis1.[26] To better understand how mitochondrial morphology is regulated by fission, we also measured the expression of Drp1 and Fis1 genes. Interestingly, the expression of fission genes revealed a tendency of latent upregulation in the osteoblast after a long DEX incubation [Figure 5]a and [Figure 5]b. [Figure 5]a shows the expressions of Drp1 remained unaltered at 4 and 12h after treatment, and slightly increased after 24h DEX incubation. The mRNA levels of Fis1 gene were not altered at 4 h after treatment and showed a slight increase at 12-h DEX exposure. After 24-h DEX incubation, the expression level of Fis1 gene was similar to the expression of Drp1 and revealed a tendency to be upregulated in the osteoblast [Figure 5]b. Notably, long incubation of DEX leads to greater variation of the expression of both fusion and fission genes. Mitochondrial staining also revealed the tendency of short mitochondria after the first 24 h of DEX incubation [Figure 5]c.
Figure 5: Mitochondrial fission genes upregulated in osteoblast after long-term incubation with dexamethasone. Quantitative levels of mitochondrial fission genes dynamin-related proteins 1 (a) and Fis1 (b) expression were measured by quantitative polymerase chain reaction in osteoblasts after exposure to 10-6 M dexamethasone for 4, 12, 24, and 48 h. The mitochondrial morphology of osteoblast was evaluated by MitoTracker staining after dexamethasone treatment (10-6 M) in osteoblast at 24 and 48 h (c). Scale bar = 10 μm. Each column represents the mean ± standard error of the mean of at least three independent experiments. *Indicate significant difference between treatment with and without dexamethasone where P < 0.05.

Click here to view



  Discussion Top


Due to the potent anti-inflammatory and immunosuppressive effects, GC and its derivatives are widely prescribed in therapeutic settings for a variety of medical conditions.[27] However, the treatment also leads to a variety of aversive side effects, including osteoporosis, water retention causing body swelling, elevated blood sugar, and many others.[28] Thus, management of the secondary diseases caused by GC treatment, such as glucocorticoid-induced osteoporosis (GIO), is of great clinical significance. The primary goal of this study is to investigate the mitochondrial alterations responding to GC stimuli in the osteoblast. Previous studies suggested that GC-induced apoptosis of osteoblast has a mitochondrial route. Activated GR increases the expression of pro-apoptotic proteins such as Bad, Bim, and Bax and subsequently induces caspase-3 activation. Our previous data suggest that a high dose of DEX does not directly generate damage to mitochondria but rather increase the mitochondrial functions. The apoptosis after long-term incubation is possibly secondary as the result of the accumulation of the ROS/reactive nitrogen species (RNS) generated by excessive oxidative phosphorylation. Based on the results of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, cell count decreased by 20% after 48 h of incubation. We guess the oxidative phosphorylation levels kept high in the majority of DEX treated osteoblasts, making the expression of ND1 and COX1 remained upregulated until apoptotic pathways turned on.

However, GC-treated mice exhibit bone loss in comparable levels with intact or disrupted GC signaling, suggesting that other mechanisms should be involved.[29] The “nongenomic” GC actions are mediated by the interactions of GC-GR complex and membranous organelles, such as mitochondrial membranes. The consequences of translocation of GC-GR complex to mitochondria appear to be cell type dependent. The GC-induced mitochondrial apoptotic pathway leads to the disruption of the mitochondrial membrane potential and the release of key apoptosis-inducing factors like cytochrome C in immune cells.[2],[30] In rat brain cells treated with corticosterone, GR binds to B-cell lymphoma 2 (Bcl-2) to prevent the leak of cytochrome C but promote calcium release from mitochondria. This GR/Bcl-2 complex moves into mitochondria and regulates mitochondrial functions in an inverted “U”-shaped manner.

Our previous data revealed that basal respiration rate and ATP production were increased in a 24-h incubation of GC. Although long-term incubation of GC caused cytochrome C release and mitochondrial breakdown, this observation suggests that the primary effects of GC on osteoblasts are to promote but not to impair the mitochondrial functions. In this study, we further elucidated the mitochondrial functions by examining the expression of two essential genes for oxidative respiration. The results support our mitochondrial promotion hypothesis. The increase of proton leak and nonmitochondrial respiration suggests a potential source of GC-induced oxidative stress. The accumulation of oxidative stress might be the major cause of the GC-induced mitochondrial breakdown.

GC might influence mitochondrial through multiple routes (genomic and nongenomic) and produce pleiotropic effects. Besides elevating mitochondrial functions, GC might have an additional impact on this organelle. In this study, we provide evidence showing that GC induced a series of alterations of mitochondrial dynamics. We demonstrated that mitochondrial biogenesis was promoted upon GC stimulation. Subsequently, mitochondrial fusion appeared to be initiated, possibly as the result of increase of oxidative respiration and mitochondrial activities. Mitochondrial fission also elevated after the long-time incubation. It is reported that mitochondrial biogenesis might trigger fission of these newly synthetic organelles. In addition, accumulation of oxidative stress also induced mitochondrial fission. The late occurrence of the mitochondrial fission suggested that this change is the secondary effect responding to mitochondrial hyperactivity or biogenesis and possibly one of the causes inducing apoptosis. Enormous variations of fusion/fission gene expression suggest that the action of DEX through different routes might mediate different impacts on mitochondrial dynamics. Moreover, the elevation of ROS/RNS and the activation of apoptotic signaling provide an additional drive for altering mitochondrial dynamics. The direct targets, including the genomic and nongenomic targets, of GC-GR complex in the osteoblast have not been identified. It is not clear whether PGC-1α and Nrf1/Nrf2 are direct targets of GC-GR. Biochemical assays will be further conducted to verify the relationship between GR activation by GC and the upregulation of the mitochondrial biogenesis, and the mechanisms of how GC elevates mitochondrial respiration should be further studied.


  Conclusion Top


The outcome of this research also provides important information about the strategy of preventing GIO. As the elevation of oxidative respiration and mitochondrial biogenesis seems to be the primary effects of GC on the osteoblast, the major cause of the GIO could be the overactivation of mitochondria and the accumulation of oxidative stress. The regulation of mitochondrial dynamics or enhancing ROS/RNS scavenging might be ideal strategies to prevent GIO.

Financial support and sponsorship

This study was financially supported by Taoyuan General Hospital, Ministry of Health and Welfare, Taoyuan, Taiwan (PTH108036, PTH108037, PTH108038).

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Seibel MJ, Cooper MS, Zhou H. Glucocorticoid-induced osteoporosis: Mechanisms, management, and future perspectives. Lancet Diabetes Endocrinol 2013;1:59-70.  Back to cited text no. 1
    
2.
Johnson TE, Vogel R, Rutledge SJ, Rodan G, Schmidt A. Thiazolidinedione effects on glucocorticoid receptor-mediated gene transcription and differentiation in osteoblastic cells. Endocrinology 1999;140:3245-54.  Back to cited text no. 2
    
3.
Zhang W, Yang N, Shi XM. Regulation of mesenchymal stem cell osteogenic differentiation by glucocorticoid-induced leucine zipper (GILZ). J Biol Chem 2008;283:4723-9.  Back to cited text no. 3
    
4.
Jeon MJ, Kim JA, Kwon SH, Kim SW, Park KS, Park SW, et al. Activation of peroxisome proliferator-activated receptor-gamma inhibits the Runx2-mediated transcription of osteocalcin in osteoblasts. J Biol Chem 2003;278:23270-7.  Back to cited text no. 4
    
5.
Almeida M, Han L, Ambrogini E, Weinstein RS, Manolagas SC. Glucocorticoids and tumor necrosis factor α increase oxidative stress and suppress Wnt protein signaling in osteoblasts. J Biol Chem 2011;286:44326-35.  Back to cited text no. 5
    
6.
Feng YL, Tang XL. Effect of glucocorticoid-induced oxidative stress on the expression of Cbfa1. Chem Biol Interact 2014;207:26-31.  Back to cited text no. 6
    
7.
Yamada M, Tsukimura N, Ikeda T, Sugita Y, Att W, Kojima N, et al. N-acetyl cysteine as an osteogenesis-enhancing molecule for bone regeneration. Biomaterials 2013;34:6147-56.  Back to cited text no. 7
    
8.
Chen YH, Peng SY, Cheng MT, Hsu YP, Huang ZX, Cheng WT, et al. Different susceptibilities of osteoclasts and osteoblasts to glucocorticoid-induced oxidative stress and mitochondrial alterations. Chin J Physiol 2019;62:70-9.  Back to cited text no. 8
[PUBMED]  [Full text]  
9.
Yudt MR, Cidlowski JA. The glucocorticoid receptor: Coding a diversity of proteins and responses through a single gene. Mol Endocrinol 2002;16:1719-26.  Back to cited text no. 9
    
10.
Saklatvala J. Glucocorticoids: Do we know how they work? Arthritis Res 2002;4:146-50.  Back to cited text no. 10
    
11.
De Bosscher K, Vanden Berghe W, Haegeman G. The interplay between the glucocorticoid receptor and nuclear factor-kappaB or activator protein-1: Molecular mechanisms for gene repression. Endocr Rev 2003;24:488-522.  Back to cited text no. 11
    
12.
Lemberger T, Staels B, Saladin R, Desvergne B, Auwerx J, Wahli W. Regulation of the peroxisome proliferator-activated receptor alpha gene by glucocorticoids. J Biol Chem 1994;269:24527-30.  Back to cited text no. 12
    
13.
Limbourg FP, Huang Z, Plumier JC, Simoncini T, Fujioka M, Tuckermann J, et al. Rapid nontranscriptional activation of endothelial nitric oxide synthase mediates increased cerebral blood flow and stroke protection by corticosteroids. J Clin Invest 2002;110:1729-38.  Back to cited text no. 13
    
14.
Löwenberg M, Verhaar AP, Bilderbeek J, Marle JV, Buttgereit F, Peppelenbosch MP, et al. Glucocorticoids cause rapid dissociation of a T-cell-receptor-associated protein complex containing LCK and FYN. EMBO Rep 2006;7:1023-9.  Back to cited text no. 14
    
15.
Bartis D, Boldizsár F, Kvell K, Szabó M, Pálinkás L, Németh P, et al. Intermolecular relations between the glucocorticoid receptor, ZAP-70 kinase, and Hsp-90. Biochem Biophys Res Commun 2007;354:253-8.  Back to cited text no. 15
    
16.
Sionov RV, Cohen O, Kfir S, Zilberman Y, Yefenof E. Role of mitochondrial glucocorticoid receptor in glucocorticoid-induced apoptosis. J Exp Med 2006;203:189-201.  Back to cited text no. 16
    
17.
Talabér G, Boldizsár F, Bartis D, Pálinkás L, Szabó M, Berta G, et al. Mitochondrial translocation of the glucocorticoid receptor in double-positive thymocytes correlates with their sensitivity to glucocorticoid-induced apoptosis. Int Immunol 2009;21:1269-76.  Back to cited text no. 17
    
18.
Du J, McEwen B, Manji HK. Glucocorticoid receptors modulate mitochondrial function: A novel mechanism for neuroprotection. Commun Integr Biol 2009;2:350-2.  Back to cited text no. 18
    
19.
Wang H, Nicolay BN, Chick JM, Gao X, Geng Y, Ren H, et al. The metabolic function of cyclin D3-CDK6 kinase in cancer cell survival. Nature 2017;546:426-30.  Back to cited text no. 19
    
20.
Liang B, Shahbaz M, Wang Y, Gao H, Fang R, Niu Z, et al. Integrinβ6-targeted immunoliposomes mediate tumor-specific drug delivery and enhance therapeutic efficacy in colon carcinoma. Clin Cancer Res 2015;21:1183-95.  Back to cited text no. 20
    
21.
Phuc Le P, Friedman JR, Schug J, Brestelli JE, Parker JB, Bochkis IM, et al. Glucocorticoid receptor-dependent gene regulatory networks. PLoS Genet 2005;1:e16.  Back to cited text no. 21
    
22.
Jornayvaz FR, Shulman GI. Regulation of mitochondrial biogenesis. Essays Biochem 2010;47:69-84.  Back to cited text no. 22
    
23.
Kelly DP, Scarpulla RC. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev 2004;18:357-68.  Back to cited text no. 23
    
24.
Kowald A, Kirkwood TB. Evolution of the mitochondrial fusion-fission cycle and its role in aging. Proc Natl Acad Sci U S A 2011;108:10237-42.  Back to cited text no. 24
    
25.
Ventura-Clapier R, Garnier A, Veksler V. Transcriptional control of mitochondrial biogenesis: the central role of PGC-1alpha. Cardiovasc Res 2008;79:208-17.  Back to cited text no. 25
    
26.
Youle RJ, van der Bliek AM. Mitochondrial fission, fusion, and stress. Science 2012;337:1062-5.  Back to cited text no. 26
    
27.
Sarinho ES, Melo VM. Glucocorticoid-induced bone disease: Mechanisms and importance in pediatric practice. Rev Paul Pediatr 2017;35:207-15.  Back to cited text no. 27
    
28.
Fraser LA, Adachi JD. Glucocorticoid-induced osteoporosis: treatment update and review. Ther Adv Musculoskelet Dis 2009;1:71-85.  Back to cited text no. 28
    
29.
Hirayama T, Sabokbar A, Athanasou NA. Effect of corticosteroids on human osteoclast formation and activity. J Endocrinol 2002;175:155-63.  Back to cited text no. 29
    
30.
Hamouda S, Yasear A. Effect of dexamethasone on osteoclast formation in the alveolar bone of rabbits. Iraqi J Vet Sci 2009;23:13-6.  Back to cited text no. 30
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]


This article has been cited by
1 Adrenergic and Glucocorticoid Receptors in the Pulmonary Health Effects of Air Pollution
Myles X. Hodge,Andres R. Henriquez,Urmila P. Kodavanti
Toxics. 2021; 9(6): 132
[Pubmed] | [DOI]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed818    
    Printed18    
    Emailed0    
    PDF Downloaded142    
    Comments [Add]    
    Cited by others 1    

Recommend this journal