• Users Online: 203
  • Print this page
  • Email this page

 
Table of Contents
ORIGINAL ARTICLE
Year : 2021  |  Volume : 64  |  Issue : 1  |  Page : 51-56

Hypermethylation of SHISA3 DNA as a blood-based biomarker for colorectal cancer


1 Division of Clinical Pathology, Department of Pathology, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan
2 Division of Colon and Rectal Surgery, Department of Surgery, Tri-Service General Hospital, National Defense Medical Center, Taipei, Taiwan
3 Geriatrics Department, Tri-Service General Hospital, Taipei, Taiwan
4 Health Management Center, Tri-Service General Hospital, Taipei, Taiwan
5 Division of Clinical Pathology, Department of Pathology, Tri-Service General Hospital; Graduate Institute of Medical Sciences, National Defense Medical Center, Taipei, Taiwan

Date of Submission28-Oct-2020
Date of Decision17-Dec-2020
Date of Acceptance31-Dec-2020
Date of Web Publication29-Jan-2021

Correspondence Address:
Dr. Bing-Heng Yang
Division of Clinical Pathology, 3F, No. 325, Sec. 2, Chenggong Road, Neihu Dist., Taipei City 114
Taiwan
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/CJP.CJP_89_20

Rights and Permissions
  Abstract 


In Taiwan, colorectal cancer (CRC) is the second most common cancer and the cancer with the third highest mortality rate. This may be because of the difficulty of detecting the disease in the early stages, as well as the fact that colonoscopy, a typical method used in screening for CRC, causes discomfort to the recipient and is prone to technical interference. For the earlier detection of CRC, finding an easier screening method with a simpler collection procedure is essential. Thus, in the present study, plasma samples from patients with CRC were analyzed to determine the extent of methylation in SHISA3 DNA. Studies have suggested that SHISA3, a newly identified tumor suppressor, can regulate tumor growth, and that the inactivation of its DNA can be traced to epigenomic alterations in CRC. Another study reported the presence of hypermethylated SHISA3 DNA in CRC biopsy specimens. In the present study, the plasma of 30 patients with CRC and nine healthy controls was collected and analyzed for the concentration of cell-free DNA through bisulfite sequencing. The methylation rates were determined. Our results have shown that an increasing amount of cell-free DNA in the group of CRC patient's plasma compared to the healthy group. Moreover, patients with later stages of CRC had higher concentrations of cell-free DNA. Notably, the methylation rate of SHISA3 was higher in the plasma of the CRC group than in that of the healthy group. The results indicated that the presence of tumor cells does not reduce the degree of SHISA3 DNA in the peripheral blood of patients with CRC. In other words, the hypermethylation of SHISA3, which inactivates the gene, is a potential cause of tumorigenesis. Furthermore, the methylation rate of SHISA3 DNA was higher in the plasma of patients with stage II CRC than in that of those with stage I CRC. In conclusion, the combination of conventional testing and screening for SHISA3 hypermethylation in plasma could improve the rate at which CRC is detected.

Keywords: Colorectal cancer, hypermethylation, SHISA3


How to cite this article:
Tang SH, Hsiao CW, Chen WL, Wu LW, Chang JB, Yang BH. Hypermethylation of SHISA3 DNA as a blood-based biomarker for colorectal cancer. Chin J Physiol 2021;64:51-6

How to cite this URL:
Tang SH, Hsiao CW, Chen WL, Wu LW, Chang JB, Yang BH. Hypermethylation of SHISA3 DNA as a blood-based biomarker for colorectal cancer. Chin J Physiol [serial online] 2021 [cited 2021 Apr 22];64:51-6. Available from: https://www.cjphysiology.org/text.asp?2021/64/1/51/308232




  Introduction Top


According to the World Health Organization, colorectal cancer (CRC) was the third and second leading cause of cancer incidence and mortality, respectively, in 2018.[1] In Taiwan, CRC is the most common cancer in men and the second most common cancer in women.[2] The fecal occult blood test (FOBT), the main method by which CRC is screened in Taiwan, can be divided into two methods: the immunochemical FOBT and the guaiac FOBT. With both tests, the false-negative rate is always increased by variations in patients' dietary habits, as well as the amount of the samples and the conditions in which they are stored.[3],[4],[5] Notably, the results of colonoscopy, a test for CRC typically administered after FOBT, are prone to interference from the operating technicians and patient pretreatment. Moreover, the discomfort that follows colonoscopy causes patients to fear the procedure. Therefore, to mitigate CRC morbidity and mortality, finding an easier screening approach with high specificity is essential.

CRC is characterized by genomic and epigenomic alterations that lead to the deregulation of cancer-related genes. For example, oncogenes and tumor-suppressor genes can become activated and inactivated, respectively.[6],[7],[8] One study indicated that the SHISA3 gene, a newly identified tumor suppressor, inhibits the invasion, migration, proliferation, and anchorage-independent growth of lung adenocarcinoma cells in mice.[9] A follow-up study found that the SHISA3 gene plays critical roles in tumor progression in various cancers, including laryngeal squamous cell carcinoma and CRC.[10],[11] These studies have established that the inactivation of the gene is mainly caused by the epigenetic changes. In CRC, the hypermethylation of this gene leads to increased cell invasion and migration, further exacerbating tumor progression.[11]

Shisa is a transmembrane, transcription factor type protein that physically interacts with immature forms of the Frizzled receptors for Wnt ligands and fibroblast growth factor (FGF) receptors within the endoplasmic reticulum to inhibit their posttranslation maturation and trafficking to the cell surface.[12],[13],[14],[15],[16] Xenopus Shisa, the founding member of the Shisa family, promotes head development by suppressing Wnt and FGF signaling.[16] Several vertebrate homologues have been identified to play oncogenic and apoptotic roles.[13],[14],[17],[18],[19],[20],[21] Shisa 3 protein inhibits tumorigenesis and metastasis in lung cancer by accelerating the degradation of β-catenin and thus counter-regulating the Wnt signaling pathway.[9] A study demonstrated that hypermethylation contributes to SHISA3 inactivation, which occurs in the vast majority of CRC tumors. Thus, SHISA3 hypermethylation constitutes a potential diagnostic indicator for risk stratification. As such, it serves as a potential reference in the development of the optimal therapeutic intervention for patients with CRC.[11]

In the present study, to identify a biomarker for CRC that was much more convenient and accurate than existing ones, we assessed the presence of SHISA3 in the plasma of patients with CRC and determined the methylation rates. Correlations between cell-free methylation of SHISA3 DNA and CRC progression were observed. The clinical relevance of the findings to future research was also discussed.


  Materials and Methods Top


Specimen collection

The participants in the CRC group, who comprised 30 individuals with sporadic CRC, were enrolled between January 2019 and April 2020. The present study was conducted at the Neihu Branch of the Tri-Service General Hospital, Taipei, and the protocol was approved by the ethics committee of the same hospital (TSGHIRB No.: 2-108-05-023) [Table 1]. All the participants received surgery for histologically verified colorectal adenocarcinoma without prior chemotherapy or radiotherapy. Peripheral blood samples were taken following surgical resection. Subsequently, the plasma was collected for DNA extraction, bisulfite conversion, and bisulfite sequencing polymerase chain reaction (PCR).
Table 1: SHISA3 methylation with clinicopathological characteristics of patients with colorectal cancer

Click here to view


The healthy group comprised nine individuals whose colonoscopy, iFOBT, and physical examination results were normal and who had never received a carcinoma diagnosis. Peripheral blood samples were taken and collected for DNA extraction, bisulfite conversion, and bisulfite sequencing PCR (BSP). The plasma and the buffy coat were immediately isolated from the samples following collection before storage in a frost-free freezer at −80°C until use.

DNA extraction

Whole blood samples were collected using ethylenediaminetetraacetic acid tubes. Genomic DNA was isolated from the plasma and buffy coat using a commercially available DNA extraction kit (QIAamp DNA Blood Mini Kit, QIAGEN GmbH, Hilden, Germany). Subsequently, the quality of nucleic acid was determined by measuring the absorbance of ultraviolet light, and the extracted DNA was resuspended in 10 mM Tris (pH 8.0–9.0) with a 260/280 nm ratio between 1.60 and 1.90. It was then stored in a frost-free freezer at −80°C until use.

Bisulfite conversion of genomic DNA

Complete bisulfite conversion of DNA was performed using an EZ DNA methylation kit (Zymo Research, Freiburg im Breisgau, Germany); 2 μg of genomic DNA was used in one conversion reaction (the conversion efficiency ≥ 99%).[22] The converted DNA was then stored in a frost-free freezer at −80°C until use.

Methylation analysis by bisulfite pyrosequencing

The template for the pyrosequencing assay was 20 ng of bisulfite-treated DNA. The PCR and sequencing primers were designed using PyroMark Assay Design Software (version 2.0; Qiagen, Hilden, Germany). PCR was performed using the designed primer (forward: GGAGGATGTATAGATTTAGGTAGGT, reverse: Biotin-CACCCACTCATCCCTTAATTCC) under the following cycling conditions: 10 min at 95°C, followed by 50 cycles of 30 s at 95°C, 30 s at 60°C, and 30 s at 72°C, respectively, and then 10 min at 72°C. To assess the specificity of the PCR assay, 5 μL of the PCR products was subjected to electrophoresis. PCR bands were evaluated semi-quantitatively by using ImageJ (version 1.53; Wayne Rasband, National Institutes of Health, Bethesda, MD, USA). Next, 10–20 μL of PCR product and 2 μL of streptavidin-coated Sepharose beads (Streptavidin Sepharose High Performance; GE Healthcare) and the Biotage PyroMark Q24 Vacuum Workstation (Biotage Inc., Uppsala, Sweden) were used to synthesize the single-strand DNA. The single-strand DNA was then conjugated to 0.3 μM SHISA3 sequencing primer (ATGTATAGATTTAGGTAGGTT). The conjugated product was subjected to quantitative pyrosequencing analysis using the PyroMark Q24 system (Biotage Inc., Uppsala, Sweden). PyroMark Q24 software was used to measure the methylation frequencies of five consecutive CpG sites and provide internal controls for the assessment of bisulfite conversion efficiency in each assay. The methylation level of the SHISA3 gene for the individual samples was presented as the mean methylation percentage of the five CpG sites.

Statistical analysis

All analyses were performed using GraphPad Prism software (version 7; GraphPad Software, Inc., San Diego, CA, USA). Group comparisons were made using the two-tailed student's t-test or one-way analysis of variance, and a P ≤ 0.05 was considered statistically significant. Receiver-operating characteristic (ROC) curve analysis was used to determine the validity parameters and set the optimal cutoff values for the quantitative variables in the prediction of a CRC diagnosis.


  Results Top


Increase in the concentration of cell-free DNA in the plasma of the colorectal cancer group with tumor progression

Overall, the concentration of cell-free DNA, which was isolated from the plasma from the participants' blood samples, was higher in the CRC group (6.65 ng/mL) than in the healthy group [Figure 1]. Using the classification system of the American Joint Committee on Cancer (AJCC), the participants in the CRC group were divided into four subgroups: stage I, II, III, and IV, respectively. The cell-free DNA concentration in early-stage CRC, that is, stages I and II was 9.83 and 8.81 ng/mL, respectively. The concentration in late-stage CRC, that is, stages III and IV was 10.09 and 55.69 ng/mL, respectively. Especially, there was a significant increase in the plasma of the patients at stage IV [Figure 1].
Figure 1: Cell-free DNA concentration in the plasma of patients with colorectal cancer of different stages. The cfDNA concentration in the healthy group was 6.65 ng/mL. Using the classification system of American Joint Committee on Cancer, the participants in the colorectal cancer group were divided into four subgroups (for colorectal cancer of stages I–IV), the cfDNA concentration of which was 9.83, 8.81, 10.09, and 55.69 ng/mL, respectively. The concentration increased gradually with tumor progression. All values displayed are means ± standard deviation. The difference of colorectal cancer groups was compared with the control group and analyzed using ANOVA. **P < 0.01, ns P > 0.05.

Click here to view


Electrophoresis was used to determine the presence of the SHISA3 gene in the plasma samples and PCR bands were evaluated semi-quantitatively by Image J. SHISA3 expression was restored in the plasma of the CRC (1.14 ± 0.21) and healthy participants (1.17 ± 0.22) [Figure 2]a and [Figure 2]b. No differences in the status of SHISA3 gene were noted between the both groups [Figure 2]b. The data suggested that the inactivation of SHISA3 is not caused by its silencing. Notably, SHISA3 was expressed in the cell-free DNA of participants in both groups.
Figure 2: Semi-quantitative polymerase chain reaction analysis of SHISA3 DNA in the plasma samples. (a) Agarose gel electrophoresis of polymerase chain reaction products. (b) Relative SHISA3 DNA levels were measured by the quantification of polymerase chain reaction band intensities using ImageJ v1.53 software. Fold change of SHISA3 DNA normalized to β-actin (= 1.0). All values displayed are means ± standard deviations. The difference of colorectal cancer groups was compared with the control group and analyzed by ANOVA. ns P > 0.05.

Click here to view


Methylation of the SHISA3 gene at individual CpG sites in the plasma samples

Relevant study has analyzed the distribution of CpG islands in a region of −1 to +1 kb relative to the transcription start site of SHISA3. Four regions were amplified in the present study. In the patients with CRC, the region defined as BSP4, which contained 24 CpG sites, exhibited considerable hypermethylation. To determine the specific rates of DNA methylation, we performed a bisulfite pyrosequencing assay at these five CpG sites [Figure 3]. In the healthy group, the mean rate was 4.69% (range 3.4%–5.6%). Mean rates in the participants with stage I, stage II, stage III, and stage IV CRC were 4.78% (range 3.4%–6.8%), 5.96% (range 4.0%–12.2%), 7.02% (range 2.8%–30.2%), and 5.3% (range 4.2%–6.2%), respectively [Figure 3]. No significant between stage differences were observed. However, the methylation rate appeared to increase with tumor progression.
Figure 3: Quantitative analysis of the methylation concentration of SHISA3 DNA in the plasma samples was performed using bisulfite pyrosequencing. In the healthy group, the methylation rate was 4.69%. In the participants with stage I and stage II colorectal cancer, the corresponding rates were 4.78% and 5.96%, respectively. In those with stage III and stage IV colorectal cancer, the corresponding rates were 7.02% and 5.2%, respectively. Data are presented as means and standard deviations. ns P > 0.05.

Click here to view


To identify the correlations between SHISA3 methylation and CRC progression, we determined the methylation rate at each of the five CpG sites. In contrast with the tumor biopsy shown before,[23] the methylation rates in the five CpG sites were <10% in the plasma of the participants in both groups. However, in the plasma of 30 patients with CRC (range 3.23%–8.7%), the methylation rates in CpG sites 12–16 were slightly higher compared with those in the plasma of the healthy participants (range 1.89%–7.56%) [Figure 4].
Figure 4: SHISA3 methylation was detected at CpG sites 12–16 in the defined region. The methylation rate in the plasma samples was <10% for both groups. No significant between-group differences were observed. Data are presented as means and standard deviations. ns P > 0.05.

Click here to view


To compare the methylation rates at individual CpG sites in patients with different stages of CRC, further analysis was performed using the AJCC classification system [Figure 5]. The mean methylation rates at CpG site 12 in patients with stage I, II, III, and IV CRC were 5.34%, 6.9%, 8.1%, and 5% (range 3%–8%, 3%–13%, 4%–31%, and 4%–6%), respectively. The corresponding rates at site 13 were 7.38%, 9.3%, 9.3%, and 8% (range: 6%–11%, 6%–15%, 3%–32%, and 7%–9%), respectively. At site 14, the corresponding rates were 5.88%, 6.2%, 7.6%, and 7.5% (range 4%–8%, 4%–13%, 4%–31%, and 5%–10%), respectively. At sites 15 and 16, the mean methylation rate was < 6% (range 2%–5.7%). The methylation rates in the plasma of the healthy participants at sites 12–16 were 6.44%, 7.5%, 4.8%, 1.9%, and 2.8% (range 4%–8%, 7%–9%, 1%–6%, 1%–3%, and 2%–4%), respectively. Overall, the methylation rates at sites 12–14 were higher than those at sites 15 and 16. Notably, although no significant between-stage differences were observed, the methylation rate increased with tumor development.
Figure 5: Comparison of SHISA3 gene methylation at CpG sites 12–16 in the defined region for patients with different stages of colorectal cancer. The methylation rate at individual CpG sites was < 10% in both the healthy group and the colorectal cancer group (regardless of stage). No significant between-group differences were observed (P > 0.05). However, the methylation rate, except that in the patients with stage IV colorectal cancer, increased with tumor growth. Data are presented as means and standard deviations. ns: Nonsignificant.

Click here to view


ROC curve analysis of SHISA3 DNA hypermethylation in blood samples as an indicator of colorectal cancer

To assess the diagnostic value of the proposed biomarker, the methylation of SHISA3 DNA in blood samples, nonparametric receiver operating characteristic (ROC) curves were generated by plotting the sensitivity versus 1 minus the specificity [Figure 6]. The ROC curve analysis revealed that the area under the ROC curve (AUC) was 0.51 (standard error = 0.103 and 99% confidence interval 0.24–0.77). The AUC of 0.508 indicated that the biomarker could not differentiate between healthy patients and patients with CRC at all.
Figure 6: Receiver operating characteristic curve of the proposed biomarker, methylation of the cell-free DNA of the SHISA3 gene. The higher the area under the ROC curve, the higher the predictive value of the biomarker. The AUC of 0.508 indicated that the biomarker could not differentiate between healthy patients and patients with colorectal cancer at all.

Click here to view



  Discussion Top


Inconvenience and discomfort during the screening process are the major reasons that rates of CRC morbidity and mortality are higher than those from other cancers. Cell-free DNA in cancer patients often bears similar genetic and epigenetic characteristics to the related tumor DNA, there is evidence that part of the cell-free DNA originates from the tumor biopsy.[24] The cause of the above reasons and the fact that cell-free DNA can easily be isolated from the circulation of patients, makes it a promising candidate as a noninvasive biomarker of cancer.[25] Many studies have shown that plasma cell-free DNA is strongly correlated with larger tumor size, tumor metastasis, and late stage.[26],[27],[28] In particular, sharp increasing of cell-free DNA has been detected in the patient's plasma at stage IV.[25] In the present study, we found that the concentration of cell-free DNA increased in the plasma of patients with CRC as the disease progressed [Figure 1]. As mentioned, SHISA3, a tumor suppressor, was observed to inhibit the invasion, migration, proliferation, and anchorage-independent growth of lung adenocarcinoma cells in a mouse model.[9],[10] The fact that this gene was expressed in the blood samples of the CRC group and the expression levels were not lower than those in the healthy group was unexpected [Figure 2]. These results indicate that the inhibition of SHISA3 in CRC is not caused by its down regulation or silencing. A 2015 study indicated that epigenetic regulation was the main cause of SHISA3 inactivation. Furthermore, SHISA3 was hypermethylated in the tumor biopsy specimens.[11] In fact, relevant studies have shown that aberrant SHISA3 methylation has been detected in many kinds of cancer biopsy, such as nasopharyngeal carcinoma, laryngeal squamous cell carcinoma, breast cancer, and especially in CRC.[10],[23],[29],[30] In the present study, our study has also repeated the experiment and accessed the similar data. Therefore, we explored the mechanism of SHISA3 inactivation through the examination of blood samples.

As mentioned, the CRC group was divided into four subgroups according to their cancer stages (I–IV). Although no significant between-subgroup differences in SHISA3 methylation were noted, methylation rates tended to increase with tumor progression [Figure 3], indicating that SHISA3 methylation was a critical factor for SHISA3 inactivation. As shown in [Figure 4], the methylation rates at CpG sites 12–14 were higher than those at sites 15 and 16. The methylation rate in the CRC population was not notably higher in the CRC group than that in the healthy group. Overall, no single CpG site specifically contributed to the observed increase in methylation rate as tumor stage progressed [Figure 4]. As shown in [Figure 5], the methylation rate at individual CpG sites exhibited a gradual increase with tumor progression, particularly with regard to patients in the stage II and stage III subgroups. In sum, CRC contributed to SHISA3 inactivation by DNA methylation at five individual CpG sites (sites 12–16) with tumor progression. Notably, the methylation rate was not higher in patients with stage IV CRC, perhaps because they were fewer in number.

ROC curve analysis [Figure 6] revealed an AUC of approximately 0.5, indicating that hypermethylation of SHISA3 DNA was not a suitable blood-based biomarker for CRC diagnosis. The rising trend and overall changes in the methylation rate with tumor progression (i.e., from stages I–IV) demonstrated that SHISA3 hypermethylation occurred in some cases [Figure 5]. Specifically, patients C2, C13, and C26 had significantly higher methylation rates at individual CpG sites. SHISA3 methylation was comparable between patients C2 and C26, who both had stage II CRC. Furthermore, patient C13, who had stage III CRC, had a notably higher methylation rate than did patients C2 and C26. SHISA3 hypermethylation was observed in the blood samples of some of the patients in the CRC group. Further investigations with larger numbers of participants with CRC are warranted to definitively determine the feasibility of this proposed blood-based biomarker for CRC diagnosis.


  Conclusion Top


Cell-free DNA concentration rose gradually with the tumor development in the CRC group. However, even under tumor development, SHISA3 expression remained detectable in the cell-free DNA, suggesting that epigenetic regulation contributed to gene inactivation. As mentioned, the SHISA3 methylation rate rose significantly with tumor progression in three participants with CRC, namely patients C2, C13, and C26. In sum, in the present study, a correlation between blood-based SHISA3 hypermethylation and tumor progression in CRC was established. The unique characteristics of the blood samples collected from these patients may aid in the identification of a potential biomarker for the diagnosis and staging of CRC. Future studies should recruit more participants and administer further tests, such as the hypothesis in the plasma of xenograft CRC mouse model and in conditional medium from human CRC cell lines. A combination of conventional screening procedures and the detection of SHISA3 hypermethylation in blood samples may constitute an alternative approach for CRC diagnosis.

Acknowledgment

We would like to thank Professor YA-CHIEN YANG for her expert advice and encouragement throughout this novel research.

Financial support and sponsorship

The study was funded by Tri-Service General Hospital Research Foundation (TSGH-C108-092).

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394-424.  Back to cited text no. 1
    
2.
Kuo CN, Liao YM, Kuo LN, Tsai HJ, Chang WC, Yen Y. Cancers in Taiwan: Practical insight from epidemiology, treatments, biomarkers, and cost. J Formos Med Assoc 2020;119:1731-41.  Back to cited text no. 2
    
3.
Winawer SJ, Fletcher RH, Miller L, Godlee F, Stolar MH, Mulrow CD, et al. Colorectal cancer screening: Clinical guidelines and rationale. Gastroenterology 1997;112:594-642.  Back to cited text no. 3
    
4.
Brown LF, Fraser CG. Effect of delay in sampling on haemoglobin determined by faecal immunochemical tests. Ann Clin Biochem 2008;45:604-5.  Back to cited text no. 4
    
5.
van Rossum LG, van Rijn AF, van Oijen MG, Fockens P, Laheij RJ, Verbeek AL, et al. False negative fecal occult blood tests due to delayed sample return in colorectal cancer screening. Int J Cancer 2009;125:746-50.  Back to cited text no. 5
    
6.
Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990;61:759-67.  Back to cited text no. 6
    
7.
Markowitz SD, Bertagnolli MM. Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med 2009;361:2449-60.  Back to cited text no. 7
    
8.
van Engeland M, Derks S, Smits KM, Meijer GA, Herman JG. Colorectal cancer epigenetics: Complex simplicity. J Clin Oncol 2011;29:1382-91.  Back to cited text no. 8
    
9.
Chen CC, Chen HY, Su KY, Hong QS, Yan BS, Chen CH, et al. Shisa3 is associated with prolonged survival through promoting β-catenin degradation in lung cancer. Am J Respir Crit Care Med 2014;190:433-44.  Back to cited text no. 9
    
10.
Shen Z, Zhou C, Li J, Ye D, Deng H, Cao B, et al. SHISA3 promoter methylation is a potential diagnostic and prognostic biomarker for laryngeal squamous cell carcinoma. Biomed Res Int 2017;2017:9058749.  Back to cited text no. 10
    
11.
Tsai MH, Chen WC, Yu SL, Chen CC, Jao TM, Huang CY, et al. DNA hypermethylation of SHISA3 in colorectal cancer: An independent predictor of poor prognosis. Ann Surg Oncol 2015;22 Suppl 3:S1481-9.  Back to cited text no. 11
    
12.
He X. Antagonizing Wnt and FGF receptors: An enemy from within (the ER). Cell 2005;120:156-8.  Back to cited text no. 12
    
13.
Hedge TA, Mason I. Expression of Shisa2, a modulator of both Wnt and Fgf signaling, in the chick embryo. Int J Dev Biol 2008;52:81-5.  Back to cited text no. 13
    
14.
Furushima K, Yamamoto A, Nagano T, Shibata M, Miyachi H, Abe T, et al. Mouse homologues of Shisa antagonistic to Wnt and Fgf signalings. Dev Biol 2007;306:480-92.  Back to cited text no. 14
    
15.
Pei J, Grishin NV. Unexpected diversity in Shisa-like proteins suggests the importance of their roles as transmembrane adaptors. Cell Signal 2012;24:758-69.  Back to cited text no. 15
    
16.
Yamamoto A, Nagano T, Takehara S, Hibi M, Aizawa S. Shisa promotes head formation through the inhibition of receptor protein maturation for the caudalizing factors, Wnt and FGF. Cell 2005;120:223-35.  Back to cited text no. 16
    
17.
Filipe M, Gonçalves L, Bento M, Silva AC, Belo JA. Comparative expression of mouse and chicken Shisa homologues during early development. Dev Dyn 2006;235:2567-73.  Back to cited text no. 17
    
18.
Zhu Y, Tsuchida A, Yamamoto A, Furukawa K, Tajima O, Tokuda N, et al. Expression and roles of a xenopus head-forming gene homologue in human cancer cell lines. Nagoya J Med Sci 2008;70:73-82.  Back to cited text no. 18
    
19.
Bourdon JC, Renzing J, Robertson PL, Fernandes KN, Lane DP. Scotin, a novel p53-inducible proapoptotic protein located in the ER and the nuclear membrane. J Cell Biol 2002;158:235-46.  Back to cited text no. 19
    
20.
Katoh Y, Katoh M. Comparative genomics on Shisa orthologs. Int J Mol Med 2005;16:181-5.  Back to cited text no. 20
    
21.
Silva AC, Filipe M, Vitorino M, Steinbeisser H, Belo JA. Developmental expression of Shisa-2 in Xenopus laevis. Int J Dev Biol 2006;50:575-9.  Back to cited text no. 21
    
22.
Holmes EE, Jung M, Meller S, Leisse A, Sailer V, Zech J, et al. Performance evaluation of kits for bisulfite-conversion of DNA from tissues, cell lines, FFPE tissues, aspirates, lavages, effusions, plasma, serum, and urine. PLoS One 2014;9:e93933.  Back to cited text no. 22
    
23.
Chen CC, Tsai MH, Chen WC, Yu SL, Jao TM, Huang CY, et al. DNA hypermethylation of SHISA3 as a mechanism of gene inactivation and as a novel prognostic biomarker in colorectal cancer. Am Soc Clin Oncol 2015;33:e14532.  Back to cited text no. 23
    
24.
Bronkhorst AJ, Ungerer V, Holdenrieder S. The emerging role of cell-free DNA as a molecular marker for cancer management. Biomol Detect Quantif 2019;17:100087.  Back to cited text no. 24
    
25.
Xu JF, Kang Q, Ma XY, Pan YM, Yang L, Jin P, et al. A novel method to detect early colorectal cancer based on chromosome copy number variation in plasma. Cell Physiol Biochem 2018;45:1444-54.  Back to cited text no. 25
    
26.
Lin LH, Chang KW, Kao SY, Cheng HW, Liu CJ. Increased plasma circulating cell-free DNA could be a potential marker for oral cancer. Int J Mol Sci 2018;19:3303.  Back to cited text no. 26
    
27.
Vivancos A, Élez E, Salazar R. Circulating cell-free DNA as predictor of treatment failure after neoadjuvant chemoradiotherapy before surgery in patients with locally advanced rectal cancer: Is it ready for primetime? Ann Oncol 2018;29:532-4.  Back to cited text no. 27
    
28.
Li H, Jing C, Wu J, Ni J, Sha H, Xu X, et al. Circulating tumor DNA detection: A potential tool for colorectal cancer management (Review). Oncol Lett 2018;17:1409-1416.  Back to cited text no. 28
    
29.
Zhang J, Li YQ, Guo R, Wang YQ, Zhang PP, Tang XR, et al. Hypermethylation of SHISA3 promotes nasopharyngeal carcinoma metastasis by reducing SGSM1 stability. Cancer Res 2019;79:747-59.  Back to cited text no. 29
    
30.
Shahzad N, Munir T, Javed M, Tasneem F, Aslam B, Ali M, et al. SHISA3, an antagonist of the Wnt/β-catenin signaling, is epigenetically silenced and its ectopic expression suppresses growth in breast cancer. PLoS One 2020;15:e0236192.  Back to cited text no. 30
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]
 
 
    Tables

  [Table 1]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed554    
    Printed14    
    Emailed0    
    PDF Downloaded76    
    Comments [Add]    

Recommend this journal