Confirming whether KLHL23 deficiency potentiates migration in urothelial carcinoma

Jei-Ming Peng; Sen-Yung Hsieh; Jai-Hong Cheng; Jia-Wun Luo; Yu-Li Su; Hao-Lun Luo

doi:10.4103/cjp.cjp_110_20

ORIGINAL ARTICLE

Year : 2021 | Volume : 64 | Issue : 3 | Page : 142-149

Confirming whether KLHL23 deficiency potentiates migration in urothelial carcinoma

Jei-Ming Peng¹, Sen-Yung Hsieh², Jai-Hong Cheng³, Jia-Wun Luo¹, Yu-Li Su⁴, Hao-Lun Luo⁵
¹ Institute for Translational Research in Biomedicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan
² Department of Gastroenterology and Hepatology, Chang Gung Memorial Hospital; Institute of Biomedical Sciences, College of Medicine, Chang Gung University, Taoyuan, Taiwan
³ Center for Shockwave Medicine and Tissue Engineering, Medical Research, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine; Department of Leisure and Sports Management, Cheng Shiu University, Kaohsiung, Taiwan
⁴ Division of Hematology Oncology, Department of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Taiwan
⁵ Department of Urology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan

Date of Submission	21-Dec-2020
Date of Decision	05-May-2021
Date of Acceptance	07-May-2021
Date of Web Publication	24-Jun-2021

Correspondence Address:
Dr. Hao-Lun Luo
Department of Urology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833
Taiwan
Dr. Jei-Ming Peng
Institute for Translational Research in Biomedicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833
Taiwan
Dr. Yu-Li Su
Division of Hematology Oncology, Department of Internal Medicine, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University, College of Medicine, Kaohsiung 833
Taiwan

Source of Support: None, Conflict of Interest: None

DOI: 10.4103/cjp.cjp_110_20

Abstract

Epithelial–mesenchymal transition (EMT) is associated with malignant tumors. In a previous study, we found that KLHL23 is a tumor suppressor gene that inhibits EMT and cancer dissemination. However, the correlation between its expression and cancer progression in urothelial carcinoma (UC) remains unknown. This study showed that the deficiency of KLHL23 in the invasive leading cancer cells is important for improving cell migration in UC. Currently, little is known about the underlying mechanisms of KLHL23-mediated cytoskeleton remodeling in the metastatic leading cells of tumors. Our findings showed that silencing of KLHL23 promotes cell migration in UC by regulating the translocation of focal adhesion proteins. Lack of KLHL23 causes abnormal formation of lamellipodia and increases the EMT phenotype and migration. Wound healing assay revealed that KLHL23 potentiates the actin bundles and intracellular focal adhesion protein formation in the invasive leading cells. Knockdown of KLHL23 abolishes the formation of actin stress fibers and translocalizes vinculin to the perimembrane, which enhances the mobility of cancer cells. To elucidate the mechanism, we found that during migration, KLHL23 appears in the leading cells in large numbers and binds to the actin stress fibers. A large amount of vinculin accumulated at both ends of the KLHL23/actin fibers, indicating an increase in cell anchorage. Thus, KLHL23 might play a critical role in enhancing actin fibers and promoting focal adhesion complex formation in the invasive leading cells. Analysis of the overall survival revealed that low KLHL23 is associated with poor survival in patients with bladder UC, indicating its clinical significance. We hypothesize that KLHL23 is involved in the formation of actin stress fibers and focal adhesion complexes in the invasive leading cells and may be associated with EMT progression and prognosis in UC patients.

Keywords: Actin cytoskeleton remodeling, bladder urothelial carcinoma, focal adhesion, migration, tumor suppressor gene

How to cite this article:
Peng JM, Hsieh SY, Cheng JH, Luo JW, Su YL, Luo HL. Confirming whether KLHL23 deficiency potentiates migration in urothelial carcinoma. Chin J Physiol 2021;64:142-9

How to cite this URL:
Peng JM, Hsieh SY, Cheng JH, Luo JW, Su YL, Luo HL. Confirming whether KLHL23 deficiency potentiates migration in urothelial carcinoma. Chin J Physiol [serial online] 2021 [cited 2023 Sep 28];64:142-9. Available from: https://www.cjphysiology.org/text.asp?2021/64/3/142/319283

Introduction

Urothelial carcinoma (UC) is a common type of bladder cancer (BLCA) worldwide. It is the 9^th, 7^th, and 14^th leading cause of mortality across the world, in the United States, and Taiwan.^[1],[2] The invasive sites of UC include the bladder, renal pelvis, ureters, and urethra. Ninety percent of UC occurs in the lower urinary tract.^[3] Approximately 75% and 20%–25% of the patients are diagnosed at an early stage (non-muscle-invasive stage) and with advanced or metastatic disease (muscle-invasive stage; ≥stage T2), respectively. Systemic platinum-based chemotherapy is the standard treatment for early-stage UC. Radical cystectomy is the gold standard for the treatment of muscle-invasive bladder cancer (MIBC).^[4] Nonetheless, half of the MIBC patients have tumor metastases within 2 years, following their diagnosis. Furthermore, the mortality rate of MIBC is extremely high.^[5] Hence, the lack of sufficient treatment for malignant UC necessitates more effective treatment methods.

Epithelial–mesenchymal transition (EMT) progression is the driving force of tumor malignancy, and the tumor microenvironment often plays a pivotal role in inducing EMT. In the process of developmental morphogenesis, EMT originally refers to the ability of epithelial cells to transform into metastatic and invasive cells.^[6] It is later used to describe cancer progression and metastasis. During the process of tumor dissemination, the EMT developmental program is restarted, many of which are similar to the EMT developmental program of epithelial cells.^[7] The major developmental signaling pathways include transforming growth factor-β (TGF-β), Wnt, Notch, growth factor receptor-related signaling processes, inflammatory cytokines, and hypoxia, and TGF-β-regulated pathways are thought to be the main cause of EMT.^[8] One of the sources of TGF-β is the stream fibroblasts in the tumor microenvironment.^[9] In addition, activation of the TGF-β/Smad signaling is also induced by activated receptor tyrosine kinases or Ras mutations to trigger EMT.^[10] Cancer cells usually metastasize after EMT progression, forming a secondary colony in the new environment. Thus, EMT facilitates tumor dissemination. The invasive front of the tumors will be transformed into a mesenchymal phenotype through EMT, allowing it to spread into the surrounding tissues (also known as intravasation).^[11],[12] However, the mechanisms of the signaling pathway and cytoskeleton remodeling of these invasive leading cells through EMT remain unclear. Therefore, uncovering the mechanism underlying the occurrence of EMT in these invasive cells will help clinicians in developing appropriate treatments.

Mechanotransduction in cancer cells involves variable processes of physical structure rearrangement that induce the conversion of mechanical stimuli into chemical signals and cause signal transduction of cell function.^{[11],[12],[13],[14]} The KLHL family regulates cytoskeleton mechanical signals, protein trafficking, cell growth, and migration through pathways through ubiquitylation and degradation of target proteins. Our previous study revealed that Kelch-Like Family Member 23 (KLHL23) is a novel tumor suppressor gene that inhibits EMT, which has an important role in cancer invasion and metastasis, through reboot actin cytoskeleton remodeling.^[15] KLHL23 is located in chromosome 2q31.1, which is a member of the bric-a-brac/tramtrack/broad-complex (BTB) domain family of proteins with an uncertain role in cancer. Silencing of KLHL23 induces tumor metastasis due to hypoxia and high cell density stress.^[15] Lack of KLHL23 triggers resistance to high cell density stress and reactivates actin cytoskeleton remodeling by inducing reactive oxygen species and EMT. Microarray analysis of mRNA, exon array, and RNA sequencing revealed that KLHL23 mutations are highly prevalent in patients with liver, lung, and pancreatic cancer.^[16],[17]

The clinical relevance of KLHL23 expression and its molecular function remains unknown. In this work, we provided evidence that KLHL23 bound and regulated the formation of actin fibers and focal adhesion complexes in the invasive leading cells. Low KLHL23 was found to increase cancer cell migration and was associated with poor survival in BLCA.

Materials and Methods

Cell culture, antibody, shRNA, and stable cell line

The UC cell line, BFTC-909 (60069, BCRC), was used in this study. Cells were incubated at 37°C in a humidified chamber with 5% CO₂. Antibodies were used at a dilution of 1:1000 for Western blotting analysis including snail (#3879, Cell Signaling), fibronectin (ab2413, Abcam), occludin (SC-133256, Santa Cruz), and KLHL23 (NBP1-57512, Novus Biologicals). Pseudolentivirus-bearing shRNAs targeting KLHL23 mRNA (shKLHL23) or an empty vector (shEV) were obtained from the National RNAi Core, Taiwan. BFTC909 cells were screened with 1.5 μg/mL puromycin for 1 week after infection of virus with shKLHL23 #1 and #2 for 2 days. The target sequences of shRNA for KLHL23 were GCTGAGTTCTATGATCCTTTA and CCTGTGTCTTACATGATGTTA. After screening, stable cell lines were determined using real-time polymerase chain reaction (PCR) to verify whether gene expression was successfully suppressed. MATERIALS

RNA extraction and quantitative reverse transcription–polymerase chain reaction

RNA was extracted from 4 × 10⁶ cells using TRIzol reagent (Invitrogen). cDNA was synthesized using SuperScript™ III Reverse Transcriptase (Invitrogen) using 2 μg RNA. Real-time PCR primers for KLHL23 were as follows: forward, 5'-ATCCCCTATCATGTGCCAGA-3'; reverse, 5'-TAGCTCCCATGATGGAAAGG-3'. GAPDH primers were as follows: forward, 5'-TGAAGGTCGGAGTCAACGGATT-3'; reverse, 5'-CCTGGAAGATGGTGATGGGATT-3'. Real-time PCR was performed using the QuantiNova SYBR Green PCR Kit (Qiagen) in a total volume of 20 μL consisting of 250 nM forward and reverse primers, 2 μL cDNA samples, 10 μL 2x QuantiNova SYBR Green PCR Master Mix, 2 μL QN ROX Reference Dye, and nuclease-free water. PCR was performed using the ABI StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific). The amplification protocol was started at 95°C for 2 min, and 40 cycles of amplification were performed (95°C for 5 s and 55°C for 10 s). PCR products were assessed using melting curve analysis (60°C for 1 m, 0.3°C increments up to 95°C). The resulting data were analyzed using the StepOne software version 2.3 provided by the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA).

Wound healing assay

The cells were seeded into a wound healing chamber in a 60-mm dish. After 36 h, the chamber was removed and fresh medium is poured into the dish, and the cells were incubated in the incubator for 18–24 h. After observing the cell status, the cells were washed three times with 1X phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde for half an hour followed by washing with 1X PBS three times.

Immunocytochemistry staining

Cell migration was assayed using the wound healing assay, the medium in the chamber slide was removed by suction, and the cells were washed with 1X PBS three times. The cells were then fixed with 4% paraformaldehyde for half an hour and washed with 1X PBS three times. Cells were punctured for 15 min with 0.1% triton X-100 and washed three times with 1X PBST. After blocking with 5% BSA for half an hour, cells were washed with 1X PBST three times. The primary antibody was diluted in 5% BSA and drops onto the cell surface followed by incubation at 4°C overnight (Vinculin, Merck; KLHL23, Sigma). The fluorescent antibody Alexa-488 (Life Technologies, A-11008) was diluted in 5% BSA at 1:200 and dropped on the cell surface for 2 h at room temperature. The cells were washed three times with 1X PBS, and the nuclei were detected by Hoechst 33342 staining (diluted in 1X PBS at 1:10000, Invitrogen) and dropped on the cell surface for 15 min. The cells were washed three times with 1X PBS and finally covered with a mounting medium (Invitrogen), and the slides were sealed with nail polish. ICC-stained cells were detected using a FluoView FV10i confocal laser scanning microscope (Olympus Corporation) at 488 nm (green), 594 nm (red), and 405 nm (blue). The images were analyzed using FV10-ASW3.1 software. Fluorescence intensity and performance were analyzed using ImageJ software (version 1.43). Statistical analyses were performed using Student's t-test (two-tailed) in GraphPad Prism 8 software (GraphPad, San Diego, CA, USA).

Real-time cell analysis cell proliferation assay

Cell proliferation assay was performed according to the real-time cell analysis (RTCA) experimental conditions of Moniri et al.^[18] The cell number was seeded 5000 cells per well. Each experiment is repeated three times followed by observation using the xCELLigence RTCA instrument (Agilent, CA) for 120 h. Setting parameters: the first step is a blank test, which is tested every 1 min for a total of 11 tests. In the second step, the cells are tested every 15 min for a total of 480 tests. For blank test, E plate will be used and 50 μl 12% DMEM will be added to each well. The experiment will be started by adding 150 μl to each well containing 5000 cells. After 18 or 120 h, the experimental results were recorded by RTCA software lite (version 2.0) and statistically analyzed using GraphPad Prism 8 software.

Real-time cell analysis cell migration assay

Cell migration assay was performed according to the RTCA experimental conditions of Moniri et al.^[18] The cell number was seeded 20000 cells per well. Each experiment is repeated three times followed by observation using the xCELLigence RTCA instrument for 18 h. A CIM-plate is used for a blank test and 160 μl DMEM with 12% FBS was added to each well of the lower chamber, and 50 μl serum-free DMEM was then added to each well of the upper chamber. The CIM-plate was incubated in an incubator at 37°C for 1 h. Then, 100 μl serum-free DMEM is added to each well containing 20,000 cells. After 18 h of migration, the experimental results were recorded by RTCA software lite version 2.0 (Agilent, Santa Clara, CA, USA) and statistically analyzed using GraphPad Prism 8 software (GraphPad, San Diego, CA, USA).

The Cancer Genome Atlas ^{More Details} human bladder cancer cohorts and data processing

The BLCA database of The Cancer Genome Atlas (TCGA) records the long-term life of BLCA in the US (up to 5000 days) and is currently a widely trusted public database. The BLCA cohort contained 428 cases, including 2, 129, 137, and 132 at tumor stages I, II, III, and IV, respectively. These cases were retrieved from the TCGA databases, queried with KLHL23, BLCA, survival rate, and gene expression as keywords. The expression of KLHL23 in patients was sorted, and Kaplan–Meier survival plots were analyzed using the UCSC Xena Functional Genomics Explorer (https://xenabrowser.net) with log-rank test statistics. The number of cases at each stage was recorded using UALCAN (http://ualcan.path.uab.edu/index. html).

Results

Lack of KLHL23 enhancing migration of urothelial carcinoma cells

EMT plays a pivotal role in tumor malignancy. In a previous study, a lentivirus-based shRNA library was used to target different genes and inhibit the expression of these genes in liver cancer cells. A transwell assay was performed to screen for potential tumor suppressor genes involved in migration. Among them, lack of KLHL23 significantly increases cell motility.^[15] We further determined whether KLHL23 affects cell migration in UC cells. shEV and shKLHL23 were introduced into the BFTC909 cells, which were obtained from UC patients. The cells were seeded into the wound healing chambers with 90% confluency. After removing the chamber and performing migration for 18 h, the cells were fixed and the migration distance was measured [Figure 1]a and [Figure 1]b. The results showed that the average wound widths in the shEV and shKLHL23 cells were 68.3–92.5 μm and 21.4–35.3 μm, respectively [[Figure 1]c, P < 0.001], indicating that the silencing of KLHL23 significantly promoted cell migration. The silencing efficacy rates of shKLHL23 #1 and #2 were 86% and 92%, respectively [Figure 1]d, P < 0.001].

Figure 1: Silencing of KLHL23 enhances the migration of urothelial cancer cells. (a) BFTC909 cells were infected with shEV or shKLHL23 virus for 48 h. After selection with puromycin, stable cells were seeded into the wound healing chamber for migration assay. (b) The BFTC909-shEV, BFTC909-shKLHL23 #1, and BFTC909-shKLHL23 #2 cells were performed migration for 18 h. The migrating cells were fixed and the distance of the wound was determined. (c) The wound distance in each sample was measured from eight fields and statistically analyzed using ImageJ software 1.51. (d) The silencing efficiency of shRNA was determined using quantitative real-time polymerase chain reaction. The results were expressed as mean ± standard deviation. ***P < 0.005. Student's t-test with two-tailed P value. Scale bars: 100 μm. (e and f) The migration and proliferation of cells were determined by using the real-time cell analysis assay for 18 h or 5 days of continuous tracking, respectively. The results were expressed as mean ± standard deviation and the slope was analyzed. *P < 0.05, ***P < 0.005. One-way ANOVA with Tukey multiple comparison.

Click here to view

The migration of cells was also determined by using the RTCA assay. The xCELLigence RTCA instrument (Agilent, CA) can continuously monitor cell migration and growth and track the process of cell growth for a long time. We performed new experiments to detect the migration of cells using the RTCA assay and performed analyses with RTCA software lite. After 18 h of continuous tracking, the migration of BFTC909-shKLHL23 #1 and #2 cells was significantly higher than that of BFTC909-shEV (cell index = 2.648, 2.865, and 0.895, respectively, P < 0.005) [Figure 1]e, P < 0.001]. We further detected and analyzed the proliferation for 18 h and 5 days using the growth rate detection module of RTCA assay. Results showed that the growth slope of BFTC909-shEV and shKLHL23 #1 and #2 showed no significant change within 18 h, and the P value of the slope of shEV and shKLHL23 #1 was 0.282, showing no significant difference. The P value of the slope of shEV and shKLHL23 #2 was 0.819, and there was no significant difference [Figure 1]f. Although the cell index of shKLHL23 #2 was higher than that of the other two cell lines after 5 days, there was no significant difference in the growth slope at the 18-h time point. In contrast, the migration ability within 18 h was significantly increased after the knockdown (KD) of KLHL23 [Figure 1]e and [Figure 1]f. Therefore, using the RTCA assay, we confirmed that KLHL23 KD reduced the migration of BFTC909 cells.

KLHL23 required for actin stress fiber formation and cell adhesion

To further investigate the mechanism of KLHL23-mediated cell mobility, we observed the morphology of shEV and shKLHL23 cells. The cells were coated with fibronectin, and wound healing assay was performed. The cells were migrated for 24 h. The cells were fixed, and the morphology of the leading cells was observed under a phase-contrast microscope. The morphology of these two cells showed no obvious difference [Figure 2]a. Because the structure of actin and arrangement of focal adhesion proteins were correlated with cell migration, immunocytochemistry (ICC) staining was performed to observe the difference in actin structure and vinculin localization between shEV and shKLHL23 cells. In BFTC909-shEV cells, the leading cells exhibit a large number of stress fibers, and their vinculin is abundantly distributed inside the cells, indicating that the cells have tightly grasped the matrix, not in motion. By contrast, silencing of KLHL23 inhibits stress fiber formation, and a large amount of vinculin is distributed around the perimembrane of cells, indicating that the cells are in the state of movement [Figure 2]a. Then, we counted the number of actin stress fibers in the leading cells and the number of vinculin intracellular in the perimembrane. The shEV cells exhibit a large number of actin stress fibers, and their vinculin is concentrated inside the cells, which slowed the movement of leading cells. The silencing of KLHL23 reduces actin stress fibers and causes vinculin translocalization to the perimembrane, helping the cells to move forward quickly [[Figure 2]b, [Figure 2]c, [Figure 2]d, P < 0.001]. The results of this study showed that there was no obvious difference in the morphology of control and KLHL23 KD cells, but the number of actin stress fibers and the position of vinculin distribution in leading cells affected the ability of cells to move. The lack of KLHL23 in the leading cells decreased the formation of intracellular actin stress fibers and production of membrane-translocalized vinculin, thereby promoting cell migration.

Figure 2: Silencing of KLHL23 reduces the formation of actin stress fibers and cell adhesion. (a) BFTC909-shEV and BFTC909-shKLHL23 cells were seeded into the wound healing chamber, and wound healing assay was performed. Actin and vinculin were detected by immunocytochemistry staining with phalloidin and anti-vinculin antibody. (b) Mean intensity of actin stress fibers was measured from cells (n = 12). (c) The intensity of merged actin and vinculin in intracellular cells was measured (n = 12). (d) The mean area of the merged vinculin in intracellular cells was measured (n = 12). The results were expressed as mean ± standard deviation. ***P < 0.005. Student's t-test with two-tailed P value. Scale bars: 10 μm.

Click here to view

KLHL23 promoting intracellular vinculin focus formation and adhesion strength

In our previous study, the actin fibers and KLHL23 expression detected in a wound healing assay were monitored by conducting an ICC staining using phalloidin and KLHL23.^[15] We found that with the formation of thin actin filaments, KLHL23 gradually transformed from subunits into filaments and bound to the actin filaments. In the leading cells, cells express a large number of actin bundles and exhibit abundant KLHL23 binding to actin bundles. Actin stress fibers are associated with the production of focal adhesion proteins in the focal adhesion foci that are necessary for cell adhesion. To understand the effect of KLHL23 on the number and localization of intracellular vinculin in the leading cells of UC, we performed an ICC staining of anti-KLHL23 and anti-vinculin antibodies in leading cells and found that when KLHL23 bundles were increased, vinculin was abundantly expressed inside these cells and localized in the front and rear ends of KHLL23 bundles [Figure 3]a. We compared the localization of vinculin between shEV and shKLHL23 cells. KLHL23 orchestrates the vinculin distribution for cell adhesion. In the absence of KLHL23, the amount of intracellular vinculin in the leading cells was significantly lower than that in shEV cells. In cells without KLHL23 bundles, vinculin was uniformly distributed or gathered in the perimembrane, and the amount of intracellular vinculin foci was significantly less [[Figure 3]b and [Figure 3]c, P < 0.001]. This finding is consistent with the results shown in [Figure 2]c and [Figure 2]d, demonstrating that KLHL23 is required for intracellular vinculin focus formation. In the absence of KLHL23, vinculin promotes cell migration and localizes to the periphery of the cells. We determined the effect of KLHL23 KD on EMT signaling in cell lines. Lysates of BFTC909-shEV and shKLHL23 #1 and #2 cells were extracted for Western blot analysis. Loss of KLHL23 significantly increased snail and fibronectin expression (over two-fold), which are known to promote cell migration. Occludin, a tight junction protein, decreased to 15% and 11% in shKLHL23 #1 and #2 cells, respectively. The expression of KLHL23 was at the bottom of the represented figure. The protein level was significantly reduced to 12% and 5% in shKLHL23 #1 and #2, respectively [Figure 3]d.

Figure 3: KLHL23 promotes intracellular vinculin focus formation and adhesion strength. The translocalization of vinculin in the perimembrane predicts the mobility status of cells. (a) Immunocytochemistry stain assay was performed to detect the expression of vinculin and KLHL23 in the leading cells. BFTC909-shEV and BFTC909-shKLHL23 were migrated for 24 h, and the cells were fixed and stained with anti-vinculin and anti-KLHL23 antibodies. (b) The intensity of merged intracellular vinculin and KLHL23 was measured (n = 12). (c) The mean area of merged vinculin in intracellular cells was measured (n = 12). The results were expressed as mean ± standard deviation. *P < 0.005. Student's t-test with two-tailed P value. Scale bars: 10 μm. (d) Lysates of stable cell lines were determined by the Western blotting analysis with antibodies specific for snail, fibronectin, occludin, and KLHL23.

Click here to view

Expression of KLHL23 as a predictor of poor clinical outcomes in BLCA

The EMT process is highly related to the occurrence of malignant tumors. Our results showed that KLHL23 affects the mobility of cancer cells by regulating cytoskeletal proteins. To further explore its correlation with clinical survival rate, we used the USCS Xena Functional Genomics Explorer (https://xenabrowser.net)^[19] and SurvExpress (http://bioinformatica.mty.itesm.mx:8080/Biomatec/SurvivaX.jsp)^[20] to analyze the expression of KLHL23 in BLCA patients and the correlation between gene expression and survival [[Figure 4]a and [Figure 4]b, respectively]. The results were expressed in statistical graphs. In the BLCA cancer population, the KLHL23 gene is expressed more in low-risk cancer patients than in high-risk cancer patients [[Figure 4]a, P < 0.001]. The 5-year survival rate of patients with low KLHL23 gene expression was significantly poor. Patients with higher KLHL23 gene expression showed better prognostic survival [Figure 4]b, P = 0.0339]. This finding indicated that the expression of KLHL23 in BLCA is related to the survival rate. Therefore, when the expression of KLHL23 is low, UC progression will increase.

Figure 4: Low KLHL23 correlates with poor survival in bladder cancer. (a) Analysis of KLHL23 and survival in bladder urothelial cancer was performed; the mean KLHL23 gene expression values in low- and high-risk groups were 1.4 and 0.4, respectively. ***P < 0.005. (b) The comparison of 5-year survival rate in bladder cancer dataset between the groups with high and low KLHL23 expression. High KLHL23, n = 210; low KLHL23, n = 214. P =0.0339, log-rank test.

Click here to view

Overall, our results showed that KLHL23 increases cell attachment by regulating the formation of actin fibers and vinculin foci during the transition from migration to attachment. KLHL23 gradually combines with actin fibers and promotes the formation of vinculin foci during the migration process. Cells that lack KLHL23 lose their ability to adhere, resulting in increased mobility. In clinical data, low KLHL23 levels are associated with poor BLCA survival, which may be due to the high migration and metastasis rates.

Discussion

Our most important finding is that the silencing of KLHL23 in BLCA cells will increase cancer cell migration. The absence of KLHL23 reduces the formation of actin bundles and intracellular focal adhesion proteins, thus indicating a decrease in cell anchorage. In addition, clinical results reveal an association between low KLHL23 and poor survival in bladder UC.

Under normal circumstances, the cells produce a feedback effect in response to high growth density. This in turn inhibits cell proliferation and migration.^{[21],[22],[23],[24]} The absence of KLHL23 in BLCA cells fails to inhibit their motility. Hence, the tumor cells continue to migrate. This eventually induces EMT and promotes tumor metastasis and dissemination. Furthermore, KLHL23 proteins can modulate cell mobility by creating an impact on the translocation of focal adhesion proteins. The focal adhesion complex is a protein group, which can be synthesized by the leading cells after migration.^[24],[25] Thus, production of the aforementioned complex will grab its matrix and halt cell migration. The focal adhesion complex cannot be generated inside the cells in the absence of KLHL23. Moreover, its continuous presence at the perimembrane allows the cells to continuously move forward.

Our findings reveal that KLHL23 affects the intracellular translocation of focal adhesion proteins (vinculin), which in turn affects the metastatic ability of tumors.^[26] Therefore, an interference with the translocation of focal adhesion protein would likely prevent or inhibit tumor metastasis and dissemination.^[27] A focal adhesion complex is required for the cancer cells to grasp the extracellular matrix.^[25],[28] Nonetheless, there is little evidence on the genes that regulate its intracellular translocation. KLHL23 primarily affects the formation of actin fibers [Figure 2]. In addition, the silencing of KLHL23 disrupts the formation of actin bundles and focal adhesion proteins inside the cells, thus causing an uncontrolled cell motility. This in sequence explains the lack of certain tumor suppressor genes in some patients that leads to the inability to produce focal adhesion proteins, thereby increasing mobility. KLHL23 regulates cell motility by binding the actin fibers and promoting the formation of intracellular vinculin [Figure 3]. Low expression of KLHL23 will increase in the mortality of patients with BLCA. This can be attributed to the correlation between low KLHL23 and the risk of metastasis and dissemination of cancer cells.

Conclusion

Therefore, KLHL23 can be used as a biomarker to predict the recurrence and metastasis of BLCA. Drugs targeted to the KLHL23-regulated mechanism may prevent and treat BLCA and metastatic cancer. In summary, the absence of KLHL23 promotes cancer cell migration. Moreover, the mechanism comprises an impact on the formation of actin fibers and the intracellular translocation of focal adhesion proteins in the invasive leading cells. The abovementioned findings can be applied to the treatment of KLHL23-mediated malignant BLCA cells.

Acknowledgments

We are grateful to the National RNAi Core of Taiwan for the lentivirus-based shRNA clones.

Financial support and sponsorship

The work was supported by research grants from Chang Gung Memorial Hospital (Grant number: CMRPG8H1041~3 and CMRPG8L0611) and Ministry of Science and Technology (Grant number: MOST108-2311-B-182A-001), Taiwan.

Conflicts of interest

There are no conflicts of interest.

References

1.	Antoni S, Ferlay J, Soerjomataram I, Znaor A, Jemal A, Bray F. Bladder cancer incidence and mortality: A global overview and recent trends. Eur Urol 2017;71:96-108.
2.	Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin 2019;69:7-34.
3.	Smith AB, Deal AM, Woods ME, Wallen EM, Pruthi RS, Chen RC, et al. Muscle-invasive bladder cancer: Evaluating treatment and survival in the National Cancer Data Base. BJU Int 2014;114:719-26.
4.	Tang K, Li H, Xia D, Hu Z, Zhuang Q, Liu J, et al. Laparoscopic versus open radical cystectomy in bladder cancer: A systematic review and meta-analysis of comparative studies. PLoS One 2014;9:e95667.
5.	Witjes JA, Compérat E, Cowan NC, De Santis M, Gakis G, Lebret T, et al. EAU guidelines on muscle-invasive and metastatic bladder cancer: Summary of the 2013 guidelines. Eur Urol 2014;65:778-92.
6.	Boyer B, Thiery JP. Epithelium-mesenchyme interconversion as example of epithelial plasticity. APMIS 1993;101:257-68.
7.	Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002;2:442-54.
8.	Katsuno Y, Lamouille S, Derynck R. TGF-β signaling and epithelial-mesenchymal transition in cancer progression. Curr Opin Oncol 2013;25:76-84.
9.	Hanahan D, Weinberg RA. Hallmarks of cancer: The next generation. Cell 2011;144:646-74.
10.	Yin S, Chen FF, Yang GF. Vimentin immunohistochemical expression as a prognostic factor in gastric cancer: A meta-analysis. Pathol Res Pract 2018;214:1376-80.
11.	Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest 2009;119:1420-8.
12.	Zhang Y, Weinberg RA. Epithelial-to-mesenchymal transition in cancer: Complexity and opportunities. Front Med 2018;12:361-73.
13.	Kovac B, Teo JL, Mäkelä TP, Vallenius T. Assembly of non-contractile dorsal stress fibers requires α-actinin-1 and Rac1 in migrating and spreading cells. J Cell Sci 2013;126:263-73.
14.	Pellegrin S, Mellor H. Actin stress fibres. J Cell Sci 2007;120:3491-9.
15.	Peng JM, Bera R, Chiou CY, Yu MC, Chen TC, Chen CW, et al. Actin cytoskeleton remodeling drives epithelial-mesenchymal transition for hepatoma invasion and metastasis in mice. Hepatology 2018;67:2226-43.
16.	Cerami E, Gao J, Dogrusoz U, Gross BE, Sumer SO, Aksoy BA, et al. The cBio cancer genomics portal: An open platform for exploring multidimensional cancer genomics data. Cancer Discov 2012;2:401-4.
17.	Gao J, Aksoy BA, Dogrusoz U, Dresdner G, Gross B, Sumer SO, et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci Signal 2013;6:pl1.
18.	Roshan Moniri M, Young A, Reinheimer K, Rayat J, Dai LJ, Warnock GL. Dynamic assessment of cell viability, proliferation and migration using real time cell analyzer system (RTCA). Cytotechnology 2015;67:379-86.
19.	Goldman M, Craft B, Hastie M, Repečka K, Kamath A, McDade F, et al. The UCSC Xena platform for public and private cancer genomics data visualization and interpretation. bioRxiv 2019:326470.
20.	Aguirre-Gamboa R, Gomez-Rueda H, Martínez-Ledesma E, Martínez-Torteya A, Chacolla-Huaringa R, Rodriguez-Barrientos A, et al. SurvExpress: An online biomarker validation tool and database for cancer gene expression data using survival analysis. PLoS One 2013;8:e74250.
21.	Chauviere A, Preziosi L, Byrne H. A model of cell migration within the extracellular matrix based on a phenotypic switching mechanism. Math Med Biol 2010;27:255-81.
22.	Koenig A, Mueller C, Hasel C, Adler G, Menke A. Collagen type I induces disruption of E-cadherin-mediated cell-cell contacts and promotes proliferation of pancreatic carcinoma cells. Cancer Res 2006;66:4662-71.
23.	Tamiya S, Liu L, Kaplan HJ. Epithelial-mesenchymal transition and proliferation of retinal pigment epithelial cells initiated upon loss of cell-cell contact. Invest Ophthalmol Vis Sci 2010;51:2755-63.
24.	Kuo JC, Han X, Hsiao CT, Yates JR 3^rd, Waterman CM. Analysis of the myosin-II-responsive focal adhesion proteome reveals a role for β-Pix in negative regulation of focal adhesion maturation. Nat Cell Biol 2011;13:383-93.
25.	van Helvert S, Storm C, Friedl P. Mechanoreciprocity in cell migration. Nat Cell Biol 2018;20:8-20.
26.	Li T, Guo H, Song Y, Zhao X, Shi Y, Lu Y, et al. Loss of vinculin and membrane-bound β-catenin promotes metastasis and predicts poor prognosis in colorectal cancer. Mol Cancer 2014;13:263.
27.	Luo M, Guan JL. Focal adhesion kinase: A prominent determinant in breast cancer initiation, progression and metastasis. Cancer Lett 2010;289:127-39.
28.	Parsons JT, Horwitz AR, Schwartz MA. Cell adhesion: Integrating cytoskeletal dynamics and cellular tension. Nat Rev Mol Cell Biol 2010;11:633-43.